Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0008334.1

Orthogroup ID

OG0014574

Physical Location & Seq

Genomic Coordinates Reverse (-)

96231 .. 96783

Gene Structure 553 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0008334.1_g000016.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 459 bp

atgggagttggaggaactttggagtacttgtctgatctaatgggtagtgctggccataaacacaaaaggaagaagcaattacagactgtggagctcaaagtcagaatggactgtgatggttgtgagcttaaggtcaagaaggccctttcttctttaagtggagttaaatctgtggagattaacagaaagcaacagaaggtgagtgttacagggtatgttgaacccaacaaggtgctgaagaaggcaaagtcaacagggaaaagggcagagatatggccttatgttccctacaatctagtggctcagccctacatggctcaagcttatgacaagaaggcacctcctggttatgtcaggaaagtggagaacactgcaactactggcaccatgacaagatatgaagatccctacaccgccatgttcagtgatgaaaaccccaacgcctgctctatcatgtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

HMA

Protein Analysis

152

Amino Acids

16.93

Weight (kDa)

9.5

Isoelectric Point (pI)

33.57

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014574)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G39700
fragaria_vesca	FvH4_1g21640
malus_domestica	MD01G1024200.v1.1 MD15G1328000.v1.1
prunus_persica	Prupe.6G179300_v2.0.a1
pyrus_communis	pycom01g05190 pycom15g29660
rosa_chinensis	RchiOBHm_Chr2g0115511
rosa_laevigata	RLG00000018189
rosa_multiflora	Rmu_sc0008334.1_g000016
rosa_roxburghii	Rroxscaffold_2G00129020
rosa_rugosa	Rorug02G0197200
rosa_samantha	Rh2AG254800 Rh2BG265500 Rh2CG260000 Rh2DG262900
rosa_wichuraiana	Rw2G019940

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	2 cut(s)	337, 383
AciI	CCGC	1 cut(s)	414
AclWI	GGATC	1 cut(s)	398
AcoI	YGGCCR	1 cut(s)	52
AcuI	CTGAAG	1 cut(s)	257
AfaI	GTAC	1 cut(s)	26
AflII	CTTAAG	1 cut(s)	128
AgsI	TTSAA	1 cut(s)	221
AjnI	CCWGG	1 cut(s)	343
AluBI	AGCT	3 cut(s)	94, 127, 323
AluI	AGCT	3 cut(s)	94, 127, 323
Alw21I	GWGCWC	1 cut(s)	96
AlwI	GGATC	1 cut(s)	398
AoxI	GGCC	3 cut(s)	52, 141, 275
AspS9I	GGNCC	1 cut(s)	142
AsuHPI	GGTGA	1 cut(s)	211
BalI	TGGCCA	1 cut(s)	54
BanI	GGYRCC	2 cut(s)	337, 383
BanII	GRGCYC	1 cut(s)	96
Bbv12I	GWGCWC	1 cut(s)	96
BccI	CCATC	1 cut(s)	110
BciT130I	CCWGG	1 cut(s)	345
BfaI	CTAG	1 cut(s)	296
BfrI	CTTAAG	1 cut(s)	128
BlpI	GCTNAGC	1 cut(s)	303
BmcAI	AGTACT	1 cut(s)	26
Bme1390I	CCNGG	1 cut(s)	345
BmgT120I	GGNCC	1 cut(s)	142
BmiI	GGNNCC	2 cut(s)	339, 385
BmrFI	CCNGG	1 cut(s)	345
Bpu1102I	GCTNAGC	1 cut(s)	303
BpuEI	CTTGAG	1 cut(s)	303
BsaXI	ACNNNNNCTCC	2 cut(s)	14, 44
Bse1I	ACTGG	1 cut(s)	385
BseBI	CCWGG	1 cut(s)	345
BseMII	CTCAG	1 cut(s)	317
BseNI	ACTGG	1 cut(s)	385
BshFI	GGCC	3 cut(s)	54, 143, 277
BshNI	GGYRCC	2 cut(s)	337, 383
BsiHKAI	GWGCWC	1 cut(s)	96
BsnI	GGCC	3 cut(s)	54, 143, 277
Bsp1286I	GDGCHC	1 cut(s)	96
Bsp143I	GATC	2 cut(s)	34, 403
Bsp1720I	GCTNAGC	1 cut(s)	303
BspACI	CCGC	1 cut(s)	414
BspANI	GGCC	3 cut(s)	54, 143, 277
BspCNI	CTCAG	1 cut(s)	316
BspLI	GGNNCC	2 cut(s)	339, 385
BspPI	GGATC	1 cut(s)	398
BspT107I	GGYRCC	2 cut(s)	337, 383
BspTI	CTTAAG	1 cut(s)	128
BsrI	ACTGG	1 cut(s)	385
BssMI	GATC	2 cut(s)	34, 403
Bst2UI	CCWGG	1 cut(s)	345
Bst4CI	ACNGT	2 cut(s)	88, 113
BstAFI	CTTAAG	1 cut(s)	128
BstC8I	GCNNGC	2 cut(s)	52, 445
BstDEI	CTNAG	1 cut(s)	303
BstKTI	GATC	2 cut(s)	37, 406
BstMBI	GATC	2 cut(s)	34, 403
BstNI	CCWGG	1 cut(s)	345
BstSCI	CCNGG	1 cut(s)	343
BstX2I	RGATCY	1 cut(s)	403
BstYI	RGATCY	1 cut(s)	403
BsuRI	GGCC	3 cut(s)	54, 143, 277
BtsI	GCAGTG	1 cut(s)	369
BtsIMutI	CAGTG	2 cut(s)	369, 430
Cac8I	GCNNGC	2 cut(s)	52, 445
Cfr13I	GGNCC	1 cut(s)	142
Csp6I	GTAC	1 cut(s)	25
CviAII	CATG	4 cut(s)	313, 388, 418, 454
CviJI	RGCY	9 cut(s)	54, 94, 127, 143, 277, 302, 307, 317, 323
CviKI_1	RGCY	9 cut(s)	54, 94, 127, 143, 277, 302, 307, 317, 323
CviQI	GTAC	1 cut(s)	25
DdeI	CTNAG	1 cut(s)	303
DpnI	GATC	2 cut(s)	36, 405
DpnII	GATC	2 cut(s)	34, 403
EaeI	YGGCCR	1 cut(s)	52
Ecl136II	GAGCTC	1 cut(s)	94
Eco24I	GRGCYC	1 cut(s)	96
Eco53kI	GAGCTC	1 cut(s)	94
Eco57I	CTGAAG	1 cut(s)	257
EcoICRI	GAGCTC	1 cut(s)	94
EcoO109I	RGGNCCY	1 cut(s)	142
EcoRII	CCWGG	1 cut(s)	343
EcoT38I	GRGCYC	1 cut(s)	96
FaeI	CATG	4 cut(s)	316, 391, 421, 457
FatI	CATG	4 cut(s)	312, 387, 417, 453
FriOI	GRGCYC	1 cut(s)	96
FspBI	CTAG	1 cut(s)	296
HaeIII	GGCC	3 cut(s)	54, 143, 277
Hin1II	CATG	4 cut(s)	316, 391, 421, 457
HincII	GTYRAC	1 cut(s)	252
HindII	GTYRAC	1 cut(s)	252
HindIII	AAGCTT	1 cut(s)	321
HphI	GGTGA	1 cut(s)	211
Hpy166II	GTNNAC	1 cut(s)	252
Hpy188I	TCNGA	2 cut(s)	34, 104
Hpy188III	TCNNGA	2 cut(s)	136, 355
Hpy8I	GTNNAC	1 cut(s)	252
HpyAV	CCTTC	4 cut(s)	133, 190, 235, 328
HpyCH4III	ACNGT	2 cut(s)	88, 113
HpyCH4V	TGCA	1 cut(s)	374
HpyF3I	CTNAG	1 cut(s)	303
Hsp92II	CATG	4 cut(s)	316, 391, 421, 457
Kzo9I	GATC	2 cut(s)	34, 403
LmnI	GCTCC	1 cut(s)	91
LpnPI	CCDG	7 cut(s)	36, 195, 240, 330, 340, 357, 366
MaeI	CTAG	1 cut(s)	296
MaeIII	GTNAC	1 cut(s)	205
MalI	GATC	2 cut(s)	36, 405
MboI	GATC	2 cut(s)	34, 403
MboII	GAAGA	4 cut(s)	82, 141, 250, 413
MflI	RGATCY	1 cut(s)	403
MhlI	GDGCHC	1 cut(s)	96
MlsI	TGGCCA	1 cut(s)	54
MluCI	AATT	1 cut(s)	77
MluNI	TGGCCA	1 cut(s)	54
MnlI	CCTC	2 cut(s)	5, 351
Mox20I	TGGCCA	1 cut(s)	54
MscI	TGGCCA	1 cut(s)	54
MseI	TTAA	4 cut(s)	129, 155, 165, 180
MslI	CAYNNNNRTG	1 cut(s)	416
Msp20I	TGGCCA	1 cut(s)	54
MspCI	CTTAAG	1 cut(s)	128
MspR9I	CCNGG	1 cut(s)	345
MvaI	CCWGG	1 cut(s)	345
NdeII	GATC	2 cut(s)	34, 403
NlaIII	CATG	4 cut(s)	316, 391, 421, 457
NlaIV	GGNNCC	2 cut(s)	339, 385
Psp124BI	GAGCTC	1 cut(s)	96
Psp6I	CCWGG	1 cut(s)	343
PspGI	CCWGG	1 cut(s)	343
PspN4I	GGNNCC	2 cut(s)	339, 385
PspPI	GGNCC	1 cut(s)	142
PsuI	RGATCY	1 cut(s)	403
RsaI	GTAC	1 cut(s)	26
RsaNI	GTAC	1 cut(s)	25
RseI	CAYNNNNRTG	1 cut(s)	416
SacI	GAGCTC	1 cut(s)	96
SaqAI	TTAA	4 cut(s)	129, 155, 165, 180
Sau3AI	GATC	2 cut(s)	34, 403
Sau96I	GGNCC	1 cut(s)	142
ScaI	AGTACT	1 cut(s)	26
ScrFI	CCNGG	1 cut(s)	345
SduI	GDGCHC	1 cut(s)	96
SetI	ASST	7 cut(s)	96, 129, 135, 201, 234, 325, 343
SmiMI	CAYNNNNRTG	1 cut(s)	416
SmlI	CTYRAG	2 cut(s)	128, 318
SmoI	CTYRAG	2 cut(s)	128, 318
Sse9I	AATT	1 cut(s)	77
SsiI	CCGC	1 cut(s)	414
SspMI	CTAG	1 cut(s)	296
SstI	GAGCTC	1 cut(s)	96
StyD4I	CCNGG	1 cut(s)	343
TaaI	ACNGT	2 cut(s)	88, 113
TasI	AATT	1 cut(s)	77
TatI	WGTACW	1 cut(s)	24
Tru1I	TTAA	4 cut(s)	129, 155, 165, 180
Tru9I	TTAA	4 cut(s)	129, 155, 165, 180
TscAI	CASTG	2 cut(s)	376, 430
TspDTI	ATGAA	2 cut(s)	414, 444
TspRI	CASTG	2 cut(s)	376, 430
Vha464I	CTTAAG	1 cut(s)	128
XspI	CTAG	1 cut(s)	296
ZrmI	AGTACT	1 cut(s)	26

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.