Rmu_sc0010369.1_g000003

Encoded by

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010369.1
Physical Location & Seq
Reverse (-)
10039 .. 10551
513 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010369.1_g000003.1.cds

Sequence Viewer

Length: 513 bp
atgagtactactgctacttctagttttaggcttcttcttgttgtgctttttggtgctttcattttcaccactggtgaaagcaggaagcttggaagtgatcaaaaaggtacctttggcgatgagaaaaatttatatcgccacccaggtcttggaggaggcggtgggggtctgggtggtggaggaggaggagggctaggcggtggtggcggagctggtgcaggaggaggagctggcttcggaggtggtgctggagcgggagctggtgggggtcttggtggaggcggtgggggaggctttggtggtggaggtggcggaggagtgggcggtggatctggttttggaggaggagctggtggaggctttggagcggggggtggtgccggtggtggagctggaggcggtggcggaggagggttcggaggtggtggcggtggaggacttgggggcggagcaggaggaggcttcggtggaggagctggtgccggtggtgggtttggaggtggattgccttga

Protein Analysis

170

Amino Acids

13.55

Weight (kDa)

9.52

Isoelectric Point (pI)

55.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017554)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G20470
fragaria_vesca FvH4_3g23040
prunus_persica Prupe.4G216800_v2.0.a1
pyrus_communis pycom11g18870
rosa_chinensis RchiOBHm_Chr5g0040571
rosa_laevigata RLG00000033988
rosa_multiflora Rmu_sc0010369.1_g000003 Rmu_sc0031031.1_g000001
rosa_roxburghii Rroxscaffold_1G00040100 Rroxscaffold_1G00040830
rosa_rugosa Rorug05G0185700.1
rosa_samantha Rh5DG285100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 107
AccB1I GGYRCC 3 cut(s) 107, 377, 479
AccB7I CCANNNNNTGG 1 cut(s) 149
AccBSI CCGCTC 2 cut(s) 254, 368
AclWI GGATC 1 cut(s) 337
AcsI RAATTY 1 cut(s) 127
AfaI GTAC 2 cut(s) 7, 109
AfiI CCNNNNNNNGG 2 cut(s) 149, 489
AjnI CCWGG 1 cut(s) 142
AluBI AGCT 7 cut(s) 88, 212, 230, 260, 350, 392, 476
AluI AGCT 7 cut(s) 88, 212, 230, 260, 350, 392, 476
AlwI GGATC 1 cut(s) 337
ApoI RAATTY 1 cut(s) 127
Asp718I GGTACC 1 cut(s) 107
AsuHPI GGTGA 2 cut(s) 58, 86
BanI GGYRCC 3 cut(s) 107, 377, 479
BciT130I CCWGG 1 cut(s) 144
BclI TGATCA 1 cut(s) 97
BfaI CTAG 2 cut(s) 21, 194
BmcAI AGTACT 1 cut(s) 7
Bme1390I CCNGG 1 cut(s) 144
BmiI GGNNCC 3 cut(s) 109, 379, 481
BmrFI CCNGG 1 cut(s) 144
BpmI CTGGAG 2 cut(s) 270, 414
BsaJI CCNNGG 1 cut(s) 142
Bsc4I CCNNNNNNNGG 2 cut(s) 149, 489
Bse118I RCCGGY 2 cut(s) 380, 482
Bse1I ACTGG 1 cut(s) 76
BseBI CCWGG 1 cut(s) 144
BseDI CCNNGG 1 cut(s) 142
BseLI CCNNNNNNNGG 2 cut(s) 149, 489
BseNI ACTGG 1 cut(s) 76
BsgI GTGCAG 1 cut(s) 237
BshNI GGYRCC 3 cut(s) 107, 377, 479
BsiSI CCGG 2 cut(s) 381, 483
BslI CCNNNNNNNGG 2 cut(s) 149, 489
Bsp143I GATC 2 cut(s) 97, 329
BspLI GGNNCC 3 cut(s) 109, 379, 481
BspPI GGATC 1 cut(s) 337
BspT107I GGYRCC 3 cut(s) 107, 377, 479
BsrBI CCGCTC 2 cut(s) 254, 368
BsrFI RCCGGY 2 cut(s) 380, 482
BsrI ACTGG 1 cut(s) 76
BssAI RCCGGY 2 cut(s) 380, 482
BssECI CCNNGG 1 cut(s) 142
BssMI GATC 2 cut(s) 97, 329
Bst2UI CCWGG 1 cut(s) 144
BstC8I GCNNGC 1 cut(s) 232
BstKTI GATC 2 cut(s) 100, 332
BstMBI GATC 2 cut(s) 97, 329
BstMWI GCNNNNNNNGC 1 cut(s) 204
BstNI CCWGG 1 cut(s) 144
BstSCI CCNGG 1 cut(s) 142
BstX2I RGATCY 1 cut(s) 329
BstYI RGATCY 1 cut(s) 329
BtgZI GCGATG 1 cut(s) 132
BtsIMutI CAGTG 1 cut(s) 69
Cac8I GCNNGC 1 cut(s) 232
Cfr10I RCCGGY 2 cut(s) 380, 482
Csp6I GTAC 2 cut(s) 6, 108
CviQI GTAC 2 cut(s) 6, 108
DpnI GATC 2 cut(s) 99, 331
DpnII GATC 2 cut(s) 97, 329
EciI GGCGGA 4 cut(s) 222, 327, 420, 462
EcoRII CCWGG 1 cut(s) 142
FaiI YATR 1 cut(s) 133
FauI CCCGC 2 cut(s) 247, 361
FbaI TGATCA 1 cut(s) 97
FspBI CTAG 2 cut(s) 21, 194
GsuI CTGGAG 2 cut(s) 270, 414
HapII CCGG 2 cut(s) 381, 483
HindIII AAGCTT 1 cut(s) 86
HpaII CCGG 2 cut(s) 381, 483
HphI GGTGA 2 cut(s) 58, 86
Hpy188I TCNGA 2 cut(s) 239, 419
HpyCH4V TGCA 1 cut(s) 218
HpyF10VI GCNNNNNNNGC 1 cut(s) 204
KpnI GGTACC 1 cut(s) 111
Ksp22I TGATCA 1 cut(s) 97
Kzo9I GATC 2 cut(s) 97, 329
LmnI GCTCC 9 cut(s) 209, 227, 251, 257, 347, 365, 389, 449, 473
MaeI CTAG 2 cut(s) 21, 194
MalI GATC 2 cut(s) 99, 331
MbiI CCGCTC 2 cut(s) 254, 368
MboI GATC 2 cut(s) 97, 329
MboII GAAGA 1 cut(s) 26
MflI RGATCY 1 cut(s) 329
MluCI AATT 1 cut(s) 127
MspI CCGG 2 cut(s) 381, 483
MspR9I CCNGG 1 cut(s) 144
MvaI CCWGG 1 cut(s) 144
MwoI GCNNNNNNNGC 1 cut(s) 204
NdeII GATC 2 cut(s) 97, 329
NlaIV GGNNCC 3 cut(s) 109, 379, 481
PflMI CCANNNNNTGG 1 cut(s) 149
Psp6I CCWGG 1 cut(s) 142
PspGI CCWGG 1 cut(s) 142
PspN4I GGNNCC 3 cut(s) 109, 379, 481
PsuI RGATCY 1 cut(s) 329
RsaI GTAC 2 cut(s) 7, 109
RsaNI GTAC 2 cut(s) 6, 108
Sau3AI GATC 2 cut(s) 97, 329
ScaI AGTACT 1 cut(s) 7
ScrFI CCNGG 1 cut(s) 144
Sse9I AATT 1 cut(s) 127
SspMI CTAG 2 cut(s) 21, 194
StyD4I CCNGG 1 cut(s) 142
TasI AATT 1 cut(s) 127
TatI WGTACW 1 cut(s) 5
TscAI CASTG 1 cut(s) 76
TspDTI ATGAA 1 cut(s) 49
TspRI CASTG 1 cut(s) 76
Van91I CCANNNNNTGG 1 cut(s) 149
XapI RAATTY 1 cut(s) 127
XcmI CCANNNNNNNNNTGG 1 cut(s) 146
XspI CTAG 2 cut(s) 21, 194
ZrmI AGTACT 1 cut(s) 7
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.