Rmu_sc0031031.1_g000001

Encoded by

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0031031.1
Physical Location & Seq
Reverse (-)
656 .. 1186
531 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0031031.1_g000001.1.cds

Sequence Viewer

Length: 531 bp
atgagtactactgctacttctagttttaggcttcttcttgttgtgctttttggtgctttcattttcaccactggtgaaagccggaagcttagaagtgatcaaaaaggtacctttggcgatgagaaaaatttatatcaccacccaggtcttggaggaggcggtgggggtctgggtggtgggggcggtggtgggcttggaggaggaggagggctaggcggtggtggcggagctggtgcaggaggaggagctggcttcggaggtggtgctggagcgggagctggtgggggtcttggtggaggcggtgggggaggctttggtggtggaggtggcggaggagtgggcggtggatctggttttggaggaggagctggtggaggctttggagcggggggtggtgccggtggtggagctggaggcggtggcggaggagggttcggaggtggtggcggtggaggacttgggggcggagcaggaggaggcttcggtggaggagctggtgccggtggtgggtttggaggtggattgccttga

Protein Analysis

176

Amino Acids

14.03

Weight (kDa)

9.52

Isoelectric Point (pI)

60.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017554)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G20470
fragaria_vesca FvH4_3g23040
prunus_persica Prupe.4G216800_v2.0.a1
pyrus_communis pycom11g18870
rosa_chinensis RchiOBHm_Chr5g0040571
rosa_laevigata RLG00000033988
rosa_multiflora Rmu_sc0010369.1_g000003 Rmu_sc0031031.1_g000001
rosa_roxburghii Rroxscaffold_1G00040100 Rroxscaffold_1G00040830
rosa_rugosa Rorug05G0185700.1
rosa_samantha Rh5DG285100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 107
AccB1I GGYRCC 3 cut(s) 107, 395, 497
AccB7I CCANNNNNTGG 1 cut(s) 149
AccBSI CCGCTC 2 cut(s) 272, 386
AclWI GGATC 1 cut(s) 355
AcsI RAATTY 1 cut(s) 127
AfaI GTAC 2 cut(s) 7, 109
AfiI CCNNNNNNNGG 2 cut(s) 149, 507
AjnI CCWGG 1 cut(s) 142
AluBI AGCT 7 cut(s) 88, 230, 248, 278, 368, 410, 494
AluI AGCT 7 cut(s) 88, 230, 248, 278, 368, 410, 494
AlwI GGATC 1 cut(s) 355
ApoI RAATTY 1 cut(s) 127
Asp718I GGTACC 1 cut(s) 107
AsuHPI GGTGA 3 cut(s) 58, 86, 128
BanI GGYRCC 3 cut(s) 107, 395, 497
BciT130I CCWGG 1 cut(s) 144
BclI TGATCA 1 cut(s) 97
BfaI CTAG 2 cut(s) 21, 212
BmcAI AGTACT 1 cut(s) 7
Bme1390I CCNGG 1 cut(s) 144
BmiI GGNNCC 3 cut(s) 109, 397, 499
BmrFI CCNGG 1 cut(s) 144
BpmI CTGGAG 2 cut(s) 288, 432
BsaJI CCNNGG 1 cut(s) 142
Bsc4I CCNNNNNNNGG 2 cut(s) 149, 507
Bse118I RCCGGY 2 cut(s) 398, 500
Bse1I ACTGG 1 cut(s) 76
BseBI CCWGG 1 cut(s) 144
BseDI CCNNGG 1 cut(s) 142
BseLI CCNNNNNNNGG 2 cut(s) 149, 507
BseNI ACTGG 1 cut(s) 76
BsgI GTGCAG 1 cut(s) 255
BshNI GGYRCC 3 cut(s) 107, 395, 497
BsiSI CCGG 3 cut(s) 82, 399, 501
BslI CCNNNNNNNGG 2 cut(s) 149, 507
Bsp143I GATC 2 cut(s) 97, 347
BspLI GGNNCC 3 cut(s) 109, 397, 499
BspPI GGATC 1 cut(s) 355
BspT107I GGYRCC 3 cut(s) 107, 395, 497
BsrBI CCGCTC 2 cut(s) 272, 386
BsrFI RCCGGY 2 cut(s) 398, 500
BsrI ACTGG 1 cut(s) 76
BssAI RCCGGY 2 cut(s) 398, 500
BssECI CCNNGG 1 cut(s) 142
BssMI GATC 2 cut(s) 97, 347
Bst2UI CCWGG 1 cut(s) 144
BstC8I GCNNGC 1 cut(s) 250
BstDEI CTNAG 1 cut(s) 89
BstKTI GATC 2 cut(s) 100, 350
BstMBI GATC 2 cut(s) 97, 347
BstMWI GCNNNNNNNGC 1 cut(s) 222
BstNI CCWGG 1 cut(s) 144
BstSCI CCNGG 1 cut(s) 142
BstX2I RGATCY 1 cut(s) 347
BstYI RGATCY 1 cut(s) 347
BtgZI GCGATG 1 cut(s) 132
BtsIMutI CAGTG 1 cut(s) 69
Cac8I GCNNGC 1 cut(s) 250
Cfr10I RCCGGY 2 cut(s) 398, 500
Csp6I GTAC 2 cut(s) 6, 108
CviQI GTAC 2 cut(s) 6, 108
DdeI CTNAG 1 cut(s) 89
DpnI GATC 2 cut(s) 99, 349
DpnII GATC 2 cut(s) 97, 347
EciI GGCGGA 4 cut(s) 240, 345, 438, 480
EcoRII CCWGG 1 cut(s) 142
FaiI YATR 1 cut(s) 133
FauI CCCGC 2 cut(s) 265, 379
FbaI TGATCA 1 cut(s) 97
FspBI CTAG 2 cut(s) 21, 212
GsuI CTGGAG 2 cut(s) 288, 432
HapII CCGG 3 cut(s) 82, 399, 501
HindIII AAGCTT 1 cut(s) 86
HpaII CCGG 3 cut(s) 82, 399, 501
HphI GGTGA 3 cut(s) 58, 86, 128
Hpy188I TCNGA 2 cut(s) 257, 437
HpyCH4V TGCA 1 cut(s) 236
HpyF10VI GCNNNNNNNGC 1 cut(s) 222
HpyF3I CTNAG 1 cut(s) 89
KpnI GGTACC 1 cut(s) 111
Ksp22I TGATCA 1 cut(s) 97
Kzo9I GATC 2 cut(s) 97, 347
LmnI GCTCC 9 cut(s) 227, 245, 269, 275, 365, 383, 407, 467, 491
MaeI CTAG 2 cut(s) 21, 212
MalI GATC 2 cut(s) 99, 349
MbiI CCGCTC 2 cut(s) 272, 386
MboI GATC 2 cut(s) 97, 347
MboII GAAGA 1 cut(s) 26
MflI RGATCY 1 cut(s) 347
MluCI AATT 1 cut(s) 127
MspI CCGG 3 cut(s) 82, 399, 501
MspR9I CCNGG 1 cut(s) 144
MvaI CCWGG 1 cut(s) 144
MwoI GCNNNNNNNGC 1 cut(s) 222
NdeII GATC 2 cut(s) 97, 347
NlaIV GGNNCC 3 cut(s) 109, 397, 499
PflMI CCANNNNNTGG 1 cut(s) 149
Psp6I CCWGG 1 cut(s) 142
PspGI CCWGG 1 cut(s) 142
PspN4I GGNNCC 3 cut(s) 109, 397, 499
PsuI RGATCY 1 cut(s) 347
RsaI GTAC 2 cut(s) 7, 109
RsaNI GTAC 2 cut(s) 6, 108
Sau3AI GATC 2 cut(s) 97, 347
ScaI AGTACT 1 cut(s) 7
ScrFI CCNGG 1 cut(s) 144
Sse9I AATT 1 cut(s) 127
SspMI CTAG 2 cut(s) 21, 212
StyD4I CCNGG 1 cut(s) 142
TasI AATT 1 cut(s) 127
TatI WGTACW 1 cut(s) 5
TscAI CASTG 1 cut(s) 76
TspDTI ATGAA 1 cut(s) 49
TspRI CASTG 1 cut(s) 76
Van91I CCANNNNNTGG 1 cut(s) 149
XapI RAATTY 1 cut(s) 127
XcmI CCANNNNNNNNNTGG 1 cut(s) 146
XspI CTAG 2 cut(s) 21, 212
ZrmI AGTACT 1 cut(s) 7
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.