Rmu_sc0010600.1_g000001

N-terminal C2 in EEIG1 and EHBP1 proteins

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010600.1
Physical Location & Seq
Reverse (-)
2 .. 1423
1422 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010600.1_g000001.1.cds

Sequence Viewer

Length: 794 bp
atgttcaagacatggagcaagaagaagaagataaaagctatattccaattgcagtttcaggcaacagaggtgccgaaattgaagaagcctgctttgatgatctctctggtgccggacgacgtgggaaagccgacggtgaaactggggaaggctgcggttcaggatgggacctgtacatgggaaaatccagtttatgagtcagtgaagctagtggaggaagcgaaatcagggaaactgaaagagaagatttatcacttcattgtttccagtggaacttcgaaatctggttatctcggagaagcttcaattgattttgcagattttgtggcagaaactgaacccttaactgtcactctaccccttaaatttgcgaattctggtgtagttttacatgtgacgattctcagggtgcaggaagatggtgattatagagaaattgaagaaaatgaggatcctagtctttcacgccatagcagcgtggacatccagaacagcaattgggatacagatggaagcaaccacctaagttttgaaaatggagcttttgatagaacaagtaatggtgccagttccttgtcaccccaaggaaaagactccatgcctcaaaatggaaaggctggtgccactgcaacaaaattaaccttggattggtcttctgatgaaagcttatttgactcaccaaatagagttgaagacaagcttccaacggaaaaagtgaaagatgtttcaggtgattccattgagaaactcagaaaggaaaatgcaatgctgatgaggcaggcggacatatcaga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

264

Amino Acids

29.09

Weight (kDa)

5.4

Isoelectric Point (pI)

29.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 4 cut(s) 70, 109, 563, 620
AciI CCGC 2 cut(s) 155, 782
AclWI GGATC 2 cut(s) 446, 459
AcsI RAATTY 2 cut(s) 365, 373
AfaI GTAC 1 cut(s) 175
AfiI CCNNNNNNNGG 3 cut(s) 177, 608, 648
AflIII ACRYGT 1 cut(s) 391
AgsI TTSAA 6 cut(s) 7, 82, 306, 440, 533, 692
AjiI CACGTC 1 cut(s) 121
AjuI GAANNNNNNNTTGG 2 cut(s) 39, 71
AluBI AGCT 6 cut(s) 38, 208, 302, 542, 666, 700
AluI AGCT 6 cut(s) 38, 208, 302, 542, 666, 700
AlwI GGATC 2 cut(s) 446, 459
AlwNI CAGNNNCTG 1 cut(s) 335
ApeKI GCWGC 2 cut(s) 152, 474
ApoI RAATTY 2 cut(s) 365, 373
AspS9I GGNCC 1 cut(s) 168
AsuHPI GGTGA 5 cut(s) 148, 434, 570, 669, 743
AsuII TTCGAA 1 cut(s) 278
AvaII GGWCC 1 cut(s) 168
BamHI GGATCC 1 cut(s) 451
BanI GGYRCC 4 cut(s) 70, 109, 563, 620
BbsI GAAGAC 2 cut(s) 645, 699
BbvI GCAGC 2 cut(s) 139, 486
BccI CCATC 3 cut(s) 158, 413, 503
BciVI GTATCC 1 cut(s) 496
BfaI CTAG 2 cut(s) 209, 456
BfuI GTATCC 1 cut(s) 496
BisI GCNGC 2 cut(s) 153, 475
BlsI GCNGC 2 cut(s) 154, 476
Bme18I GGWCC 1 cut(s) 168
BmgBI CACGTC 1 cut(s) 121
BmgT120I GGNCC 1 cut(s) 168
BmiI GGNNCC 6 cut(s) 72, 111, 169, 453, 565, 622
BmrI ACTGGG 1 cut(s) 152
BmuI ACTGGG 1 cut(s) 152
BpiI GAAGAC 2 cut(s) 645, 699
Bpu14I TTCGAA 1 cut(s) 278
BsaJI CCNNGG 2 cut(s) 583, 642
Bsc4I CCNNNNNNNGG 3 cut(s) 177, 608, 648
Bse1I ACTGG 4 cut(s) 147, 188, 267, 567
Bse3DI GCAATG 1 cut(s) 771
BseDI CCNNGG 2 cut(s) 583, 642
BseGI GGATG 2 cut(s) 169, 483
BseLI CCNNNNNNNGG 3 cut(s) 177, 608, 648
BseMI GCAATG 1 cut(s) 771
BseMII CTCAG 2 cut(s) 418, 763
BseNI ACTGG 4 cut(s) 147, 188, 267, 567
BseXI GCAGC 2 cut(s) 139, 486
BsgI GTGCAG 1 cut(s) 431
BshNI GGYRCC 4 cut(s) 70, 109, 563, 620
BsiSI CCGG 1 cut(s) 113
BslFI GGGAC 1 cut(s) 181
BslI CCNNNNNNNGG 3 cut(s) 177, 608, 648
BsmFI GGGAC 1 cut(s) 181
Bsp119I TTCGAA 1 cut(s) 278
Bsp1407I TGTACA 1 cut(s) 173
Bsp143I GATC 2 cut(s) 99, 451
BspACI CCGC 2 cut(s) 155, 782
BspCNI CTCAG 2 cut(s) 417, 762
BspLI GGNNCC 6 cut(s) 72, 111, 169, 453, 565, 622
BspPI GGATC 2 cut(s) 446, 459
BspT104I TTCGAA 1 cut(s) 278
BspT107I GGYRCC 4 cut(s) 70, 109, 563, 620
BsrDI GCAATG 1 cut(s) 771
BsrGI TGTACA 1 cut(s) 173
BsrI ACTGG 4 cut(s) 147, 188, 267, 567
BssECI CCNNGG 2 cut(s) 583, 642
BssMI GATC 2 cut(s) 99, 451
BssT1I CCWWGG 2 cut(s) 583, 642
Bst4CI ACNGT 2 cut(s) 136, 349
BstAUI TGTACA 1 cut(s) 173
BstBI TTCGAA 1 cut(s) 278
BstC8I GCNNGC 2 cut(s) 90, 780
BstDEI CTNAG 3 cut(s) 404, 524, 749
BstF5I GGATG 2 cut(s) 169, 483
BstKTI GATC 2 cut(s) 102, 454
BstMBI GATC 2 cut(s) 99, 451
BstMWI GCNNNNNNNGC 2 cut(s) 474, 775
BstNSI RCATGY 1 cut(s) 395
BstV1I GCAGC 2 cut(s) 139, 486
BstV2I GAAGAC 2 cut(s) 645, 699
BstX2I RGATCY 1 cut(s) 451
BstYI RGATCY 1 cut(s) 451
BsuI GTATCC 1 cut(s) 496
BtrI CACGTC 1 cut(s) 121
BtsCI GGATG 2 cut(s) 169, 483
BtsI GCAGTG 1 cut(s) 624
BtsIMutI CAGTG 3 cut(s) 207, 274, 624
Cac8I GCNNGC 2 cut(s) 90, 780
CaiI CAGNNNCTG 1 cut(s) 335
Cfr13I GGNCC 1 cut(s) 168
Csp6I GTAC 1 cut(s) 174
CviAII CATG 4 cut(s) 12, 177, 392, 598
CviQI GTAC 1 cut(s) 174
DdeI CTNAG 3 cut(s) 404, 524, 749
DpnI GATC 2 cut(s) 101, 453
DpnII GATC 2 cut(s) 99, 451
Eco130I CCWWGG 2 cut(s) 583, 642
Eco47I GGWCC 1 cut(s) 168
EcoO109I RGGNCCY 1 cut(s) 168
EcoRI GAATTC 1 cut(s) 373
EcoT14I CCWWGG 2 cut(s) 583, 642
ErhI CCWWGG 2 cut(s) 583, 642
FaeI CATG 4 cut(s) 15, 180, 395, 601
FaiI YATR 9 cut(s) 13, 41, 178, 195, 393, 429, 471, 599, 788
FalI AAGNNNNNCTT 2 cut(s) 684, 716
FaqI GGGAC 1 cut(s) 181
FatI CATG 4 cut(s) 11, 176, 391, 597
Fnu4HI GCNGC 2 cut(s) 153, 475
FokI GGATG 2 cut(s) 176, 470
Fsp4HI GCNGC 2 cut(s) 153, 475
FspBI CTAG 2 cut(s) 209, 456
GluI GCNGC 2 cut(s) 153, 475
HapII CCGG 1 cut(s) 113
Hin1II CATG 4 cut(s) 15, 180, 395, 601
HindIII AAGCTT 3 cut(s) 300, 664, 698
HinfI GANTC 5 cut(s) 197, 400, 593, 674, 734
HpaII CCGG 1 cut(s) 113
HphI GGTGA 5 cut(s) 148, 434, 570, 669, 743
Hpy166II GTNNAC 1 cut(s) 481
Hpy188I TCNGA 4 cut(s) 296, 658, 752, 793
Hpy188III TCNNGA 3 cut(s) 7, 161, 487
Hpy8I GTNNAC 1 cut(s) 481
Hpy99I CGWCG 2 cut(s) 122, 136
HpyAV CCTTC 1 cut(s) 142
HpyCH4III ACNGT 2 cut(s) 136, 349
HpyCH4IV ACGT 1 cut(s) 120
HpyCH4V TGCA 5 cut(s) 52, 317, 412, 629, 764
HpyF10VI GCNNNNNNNGC 2 cut(s) 474, 775
HpyF3I CTNAG 3 cut(s) 404, 524, 749
HpySE526I ACGT 1 cut(s) 120
Hsp92II CATG 4 cut(s) 15, 180, 395, 601
Kzo9I GATC 2 cut(s) 99, 451
LmnI GCTCC 2 cut(s) 15, 539
Lsp1109I GCAGC 2 cut(s) 139, 486
MaeI CTAG 2 cut(s) 209, 456
MaeII ACGT 1 cut(s) 120
MaeIII GTNAC 3 cut(s) 349, 394, 576
MalI GATC 2 cut(s) 101, 453
MboI GATC 2 cut(s) 99, 451
MboII GAAGA 9 cut(s) 34, 37, 40, 94, 256, 428, 452, 645, 704
MfeI CAATTG 3 cut(s) 47, 306, 496
MflI RGATCY 1 cut(s) 451
MluCI AATT 8 cut(s) 47, 77, 306, 365, 373, 435, 496, 635
MlyI GAGTC 3 cut(s) 206, 587, 668
MmeI TCCRAC 1 cut(s) 728
MnlI CCTC 5 cut(s) 61, 208, 442, 612, 768
MseI TTAA 3 cut(s) 344, 363, 638
MspI CCGG 1 cut(s) 113
MunI CAATTG 3 cut(s) 47, 306, 496
MwoI GCNNNNNNNGC 2 cut(s) 474, 775
NdeII GATC 2 cut(s) 99, 451
NlaIII CATG 4 cut(s) 15, 180, 395, 601
NlaIV GGNNCC 6 cut(s) 72, 111, 169, 453, 565, 622
NmuCI GTSAC 3 cut(s) 349, 394, 576
NspI RCATGY 1 cut(s) 395
NspV TTCGAA 1 cut(s) 278
PciI ACATGT 1 cut(s) 391
PfeI GAWTC 2 cut(s) 400, 734
PkrI GCNGC 2 cut(s) 154, 476
PleI GAGTC 3 cut(s) 205, 587, 668
PpsI GAGTC 3 cut(s) 205, 587, 668
PpuMI RGGWCCY 1 cut(s) 168
PscI ACATGT 1 cut(s) 391
Psp5II RGGWCCY 1 cut(s) 168
PspN4I GGNNCC 6 cut(s) 72, 111, 169, 453, 565, 622
PspPI GGNCC 1 cut(s) 168
PspPPI RGGWCCY 1 cut(s) 168
PstNI CAGNNNCTG 1 cut(s) 335
PsuI RGATCY 1 cut(s) 451
RsaI GTAC 1 cut(s) 175
RsaNI GTAC 1 cut(s) 174
SaqAI TTAA 3 cut(s) 344, 363, 638
SatI GCNGC 2 cut(s) 153, 475
Sau3AI GATC 2 cut(s) 99, 451
Sau96I GGNCC 1 cut(s) 168
SchI GAGTC 3 cut(s) 206, 587, 668
SfuI TTCGAA 1 cut(s) 278
SinI GGWCC 1 cut(s) 168
Sse9I AATT 8 cut(s) 47, 77, 306, 365, 373, 435, 496, 635
SsiI CCGC 2 cut(s) 155, 782
SspMI CTAG 2 cut(s) 209, 456
StyI CCWWGG 2 cut(s) 583, 642
TaaI ACNGT 2 cut(s) 136, 349
TaiI ACGT 1 cut(s) 123
TaqI TCGA 1 cut(s) 278
TasI AATT 8 cut(s) 47, 77, 306, 365, 373, 435, 496, 635
TatI WGTACW 1 cut(s) 173
TfiI GAWTC 2 cut(s) 400, 734
Tru1I TTAA 3 cut(s) 344, 363, 638
Tru9I TTAA 3 cut(s) 344, 363, 638
TscAI CASTG 3 cut(s) 207, 274, 631
TseFI GTSAC 3 cut(s) 349, 394, 576
TseI GCWGC 2 cut(s) 152, 474
Tsp45I GTSAC 3 cut(s) 349, 394, 576
TspDTI ATGAA 2 cut(s) 247, 675
TspGWI ACGGA 1 cut(s) 722
TspRI CASTG 3 cut(s) 207, 274, 631
VpaK11BI GGWCC 1 cut(s) 168
XapI RAATTY 2 cut(s) 365, 373
XceI RCATGY 1 cut(s) 395
XspI CTAG 2 cut(s) 209, 456
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.