Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0011074.1

Orthogroup ID

OG0015446

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 2451

Gene Structure 2451 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0011074.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1294 bp

atgatggtatcgtctggtgtggttggtagagagaacagagctgaatacacaggtatctggtcccaacccaacagtgcgaattacactcagtgcattgaccatccaaaaagccacaaaaagctagatccaaagaccaatggttacattcttataaatgccaatggtggcttgaatcagatgagatttgggatttgtgatatggttgctgttgctaagattatgaaggcaacgcttgtcctaccttcacttgatcacacctcctactgggctgatgagagtggctttaaagatctgtttgattggcaacacttcattgagacattgaaggatgatatccacatagttgagacattaccacctgaatatgcaggaattgaacctttcaacaaaacaccaatatcttggtctaaggcaagttattataagtcagaggttctcccactgctgaagcagcacacggcagtctatctcactcatactgattctcggctttccaacaattggcttccaagttccattcaaaaactgaggtgtcgtgtgaattacagggcattgaaatactcagctccaatagaagaactcggaaaaaccttggtttctagaatgaggcagaatggaggtccttaccttgctctccacttgaggtatgagaaggatatgcttgcatttacgggctgcagtcatagtttgacagcagaagaggatgaagaactacgcagaatgcgctatgaagtcagccactggaaggagaaagagattaatgggacagagagaaggttgcttggtggttgtccattgacccctagggagacttctcttttgctccgagggctgggttttccttcaagcaccaggatttacttggtagctggtgaagcttatgggaatggtagtatgcgacatcttgaggatgacttcccgaacatcttctcccattcgactctcgcctcagaagaagaactgagtccattcagggatcatcagaacatgttggctggtatagactatgctgttgccttagagagtgatgcttttctttatacatatgatggaaacatggcaaaagctgttcaagggcataggcgctttgagaactttaagaagaccatcaatccagacaagatgaattttgtgaaacttgttgatgattttgaccaaggaaaaatctcttggaagaagtttagttctaaggtgaagaagcttcaccatgacagagatgggtctccatatttgagggagcctggagagtttccgaagctggaagagagtttctatgcaaatccctttccaggct

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005794 GO:0009507 GO:0009536 GO:0012505 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

O-FucT

Protein Analysis

431

Amino Acids

49.28

Weight (kDa)

6.98

Isoelectric Point (pI)

38.61

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015446)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G35570
fragaria_vesca	FvH4_1g08590
malus_domestica	MD02G1090100.v1.1 MD15G1216700.v1.1
prunus_persica	Prupe.7G199900_v2.0.a1
pyrus_communis	pycom02g07200
rosa_chinensis	RchiOBHm_Chr2g0094811
rosa_laevigata	RLG00000016523
rosa_multiflora	Rmu_sc0006422.1_g000026 Rmu_sc0011074.1_g000001
rosa_roxburghii	Rroxscaffold_2G00146850
rosa_rugosa	Rorug02G0047100
rosa_samantha	Rh2AG094600 Rh2BG095200 Rh2CG097000 Rh2DG094000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	2 cut(s)	152, 423
AccB7I	CCANNNNNTGG	1 cut(s)	501
AclWI	GGATC	2 cut(s)	119, 984
AcsI	RAATTY	1 cut(s)	1126
AcuI	CTGAAG	1 cut(s)	467
AdeI	CACNNNGTG	1 cut(s)	90
AfiI	CCNNNNNNNGG	5 cut(s)	264, 501, 745, 832, 1289
AflIII	ACRYGT	1 cut(s)	987
AgsI	TTSAA	8 cut(s)	172, 325, 377, 385, 521, 556, 846, 1073
AjnI	CCWGG	3 cut(s)	851, 1240, 1288
AjuI	GAANNNNNNNTTGG	2 cut(s)	1153, 1185
AloI	GAACNNNNNNTCC	2 cut(s)	914, 946
AluBI	AGCT	8 cut(s)	41, 121, 566, 869, 878, 1067, 1201, 1258
AluI	AGCT	8 cut(s)	41, 121, 566, 869, 878, 1067, 1201, 1258
Alw26I	GTCTC	4 cut(s)	311, 341, 803, 1227
AlwI	GGATC	2 cut(s)	119, 984
AlwNI	CAGNNNCTG	1 cut(s)	741
ApeKI	GCWGC	2 cut(s)	451, 675
ApoI	RAATTY	1 cut(s)	1126
ArsI	GACNNNNNNTTYG	2 cut(s)	802, 834
AseI	ATTAAT	1 cut(s)	759
Asp700I	GAANNNNTTC	1 cut(s)	926
AspA2I	CCTAGG	1 cut(s)	803
AspLEI	GCGC	2 cut(s)	726, 1086
AspS9I	GGNCC	2 cut(s)	60, 620
AsuHPI	GGTGA	3 cut(s)	884, 1196, 1204
AvaII	GGWCC	2 cut(s)	60, 620
AvrII	CCTAGG	1 cut(s)	803
BaeI	ACNNNNGTAYC	2 cut(s)	37, 70
BbsI	GAAGAC	1 cut(s)	1109
BbvI	GCAGC	2 cut(s)	463, 662
BccI	CCATC	4 cut(s)	108, 1043, 1115, 1211
BceAI	ACGGC	1 cut(s)	474
BciT130I	CCWGG	3 cut(s)	853, 1242, 1290
BclI	TGATCA	1 cut(s)	250
BcoDI	GTCTC	4 cut(s)	311, 341, 803, 1227
BfaI	CTAG	3 cut(s)	122, 600, 804
BfmI	CTRYAG	1 cut(s)	676
BfoI	RGCGCY	1 cut(s)	1087
BglII	AGATCT	1 cut(s)	289
BisI	GCNGC	2 cut(s)	452, 676
BlnI	CCTAGG	1 cut(s)	803
BlsI	GCNGC	2 cut(s)	453, 677
Bme1390I	CCNGG	3 cut(s)	853, 1242, 1290
Bme18I	GGWCC	2 cut(s)	60, 620
BmgT120I	GGNCC	2 cut(s)	60, 620
BmiI	GGNNCC	2 cut(s)	62, 1239
BmrFI	CCNGG	3 cut(s)	853, 1242, 1290
BmrI	ACTGGG	1 cut(s)	274
BmsI	GCATC	1 cut(s)	1018
BmuI	ACTGGG	1 cut(s)	274
BpiI	GAAGAC	1 cut(s)	1109
BpmI	CTGGAG	1 cut(s)	1263
BpuEI	CTTGAG	2 cut(s)	661, 926
BsaI	GGTCTC	1 cut(s)	1227
BsaJI	CCNNGG	4 cut(s)	591, 803, 826, 1156
BsaXI	ACNNNNNCTCC	2 cut(s)	914, 944
Bsc4I	CCNNNNNNNGG	5 cut(s)	264, 501, 745, 832, 1289
Bse1I	ACTGG	2 cut(s)	269, 746
BseBI	CCWGG	3 cut(s)	853, 1242, 1290
BseDI	CCNNGG	4 cut(s)	591, 803, 826, 1156
BseGI	GGATG	4 cut(s)	100, 334, 709, 916
BseLI	CCNNNNNNNGG	5 cut(s)	264, 501, 745, 832, 1289
BseMII	CTCAG	5 cut(s)	101, 518, 576, 953, 963
BseNI	ACTGG	2 cut(s)	269, 746
BseXI	GCAGC	2 cut(s)	463, 662
BseYI	CCCAGC	1 cut(s)	832
BslFI	GGGAC	2 cut(s)	46, 778
BslI	CCNNNNNNNGG	5 cut(s)	264, 501, 745, 832, 1289
BsmAI	GTCTC	4 cut(s)	311, 341, 803, 1227
BsmFI	GGGAC	2 cut(s)	46, 778
BsmI	GAATGC	1 cut(s)	726
Bso31I	GGTCTC	1 cut(s)	1227
Bsp143I	GATC	4 cut(s)	124, 250, 289, 976
BspCNI	CTCAG	5 cut(s)	100, 519, 575, 954, 962
BspLI	GGNNCC	2 cut(s)	62, 1239
BspMAI	CTGCAG	1 cut(s)	680
BspPI	GGATC	2 cut(s)	119, 984
BspTNI	GGTCTC	1 cut(s)	1227
BsrI	ACTGG	2 cut(s)	269, 746
BssECI	CCNNGG	4 cut(s)	591, 803, 826, 1156
BssMI	GATC	4 cut(s)	124, 250, 289, 976
BssT1I	CCWWGG	3 cut(s)	591, 803, 1156
Bst2UI	CCWGG	3 cut(s)	853, 1242, 1290
Bst4CI	ACNGT	1 cut(s)	74
Bst6I	CTCTTC	2 cut(s)	693, 1257
BstC8I	GCNNGC	1 cut(s)	663
BstDEI	CTNAG	9 cut(s)	87, 213, 408, 527, 562, 949, 962, 1018, 1188
BstF5I	GGATG	4 cut(s)	100, 334, 709, 916
BstH2I	RGCGCY	1 cut(s)	1087
BstHHI	GCGC	2 cut(s)	726, 1086
BstKTI	GATC	4 cut(s)	127, 253, 292, 979
BstMAI	GTCTC	4 cut(s)	311, 341, 803, 1227
BstMBI	GATC	4 cut(s)	124, 250, 289, 976
BstMWI	GCNNNNNNNGC	4 cut(s)	451, 723, 829, 875
BstNI	CCWGG	3 cut(s)	853, 1242, 1290
BstNSI	RCATGY	1 cut(s)	991
BstSCI	CCNGG	3 cut(s)	851, 1240, 1288
BstSFI	CTRYAG	1 cut(s)	676
BstV1I	GCAGC	2 cut(s)	463, 662
BstV2I	GAAGAC	1 cut(s)	1109
BstX2I	RGATCY	2 cut(s)	124, 289
BstXI	CCANNNNNNTGG	1 cut(s)	402
BstYI	RGATCY	2 cut(s)	124, 289
BtsCI	GGATG	4 cut(s)	100, 334, 709, 916
BtsI	GCAGTG	1 cut(s)	440
BtsIMutI	CAGTG	4 cut(s)	79, 95, 440, 739
Cac8I	GCNNGC	1 cut(s)	663
CaiI	CAGNNNCTG	1 cut(s)	741
CfoI	GCGC	2 cut(s)	726, 1086
Cfr13I	GGNCC	2 cut(s)	60, 620
CviAII	CATG	3 cut(s)	988, 1057, 1208
DdeI	CTNAG	9 cut(s)	87, 213, 408, 527, 562, 949, 962, 1018, 1188
DpnI	GATC	4 cut(s)	126, 252, 291, 978
DpnII	GATC	4 cut(s)	124, 250, 289, 976
DraI	TTTAAA	1 cut(s)	286
DraIII	CACNNNGTG	1 cut(s)	90
Eam1104I	CTCTTC	2 cut(s)	693, 1257
EarI	CTCTTC	2 cut(s)	693, 1257
Eco130I	CCWWGG	3 cut(s)	591, 803, 1156
Eco31I	GGTCTC	1 cut(s)	1227
Eco32I	GATATC	1 cut(s)	334
Eco47I	GGWCC	2 cut(s)	60, 620
Eco57I	CTGAAG	1 cut(s)	467
EcoO109I	RGGNCCY	1 cut(s)	620
EcoRII	CCWGG	3 cut(s)	851, 1240, 1288
EcoRV	GATATC	1 cut(s)	334
EcoT14I	CCWWGG	3 cut(s)	591, 803, 1156
ErhI	CCWWGG	3 cut(s)	591, 803, 1156
FaeI	CATG	3 cut(s)	991, 1060, 1211
FaqI	GGGAC	2 cut(s)	46, 778
FatI	CATG	3 cut(s)	987, 1056, 1207
FauNDI	CATATG	1 cut(s)	1045
FbaI	TGATCA	1 cut(s)	250
Fnu4HI	GCNGC	2 cut(s)	452, 676
FokI	GGATG	4 cut(s)	87, 341, 716, 923
Fsp4HI	GCNGC	2 cut(s)	452, 676
FspBI	CTAG	3 cut(s)	122, 600, 804
GlaI	GCGC	2 cut(s)	725, 1085
GluI	GCNGC	2 cut(s)	452, 676
GsaI	CCCAGC	1 cut(s)	836
GsuI	CTGGAG	1 cut(s)	1263
HaeII	RGCGCY	1 cut(s)	1087
HhaI	GCGC	2 cut(s)	726, 1086
Hin1II	CATG	3 cut(s)	991, 1060, 1211
Hin6I	GCGC	2 cut(s)	724, 1084
HinP1I	GCGC	2 cut(s)	724, 1084
HindIII	AAGCTT	2 cut(s)	876, 1199
HinfI	GANTC	4 cut(s)	172, 482, 940, 964
HphI	GGTGA	3 cut(s)	884, 1196, 1204
Hpy188I	TCNGA	7 cut(s)	177, 430, 584, 827, 952, 984, 1254
Hpy188III	TCNNGA	4 cut(s)	600, 905, 919, 1115
HpyAV	CCTTC	7 cut(s)	217, 252, 319, 646, 739, 768, 852
HpyCH4III	ACNGT	1 cut(s)	74
HpyCH4V	TGCA	5 cut(s)	93, 368, 665, 678, 1277
HpyF10VI	GCNNNNNNNGC	4 cut(s)	451, 723, 829, 875
HpyF3I	CTNAG	9 cut(s)	87, 213, 408, 527, 562, 949, 962, 1018, 1188
Hsp92II	CATG	3 cut(s)	991, 1060, 1211
HspAI	GCGC	2 cut(s)	724, 1084
Ksp22I	TGATCA	1 cut(s)	250
Kzo9I	GATC	4 cut(s)	124, 250, 289, 976
LmnI	GCTCC	3 cut(s)	571, 828, 1237
Lsp1109I	GCAGC	2 cut(s)	463, 662
LweI	GCATC	1 cut(s)	1018
MaeI	CTAG	3 cut(s)	122, 600, 804
MaeIII	GTNAC	1 cut(s)	140
MalI	GATC	4 cut(s)	126, 252, 291, 978
MboI	GATC	4 cut(s)	124, 250, 289, 976
MfeI	CAATTG	1 cut(s)	499
MflI	RGATCY	2 cut(s)	124, 289
MluCI	AATT	5 cut(s)	79, 372, 499, 541, 1126
MlyI	GAGTC	2 cut(s)	934, 973
MmeI	TCCRAC	1 cut(s)	519
MroXI	GAANNNNTTC	1 cut(s)	926
MseI	TTAA	3 cut(s)	285, 759, 1098
MspR9I	CCNGG	3 cut(s)	853, 1242, 1290
MunI	CAATTG	1 cut(s)	499
Mva1269I	GAATGC	1 cut(s)	726
MvaI	CCWGG	3 cut(s)	853, 1242, 1290
MwoI	GCNNNNNNNGC	4 cut(s)	451, 723, 829, 875
NdeI	CATATG	1 cut(s)	1045
NdeII	GATC	4 cut(s)	124, 250, 289, 976
NlaIII	CATG	3 cut(s)	991, 1060, 1211
NlaIV	GGNNCC	2 cut(s)	62, 1239
NmeAIII	GCCGAG	1 cut(s)	466
NspI	RCATGY	1 cut(s)	991
PciI	ACATGT	1 cut(s)	987
PctI	GAATGC	1 cut(s)	726
PdmI	GAANNNNTTC	1 cut(s)	926
PfeI	GAWTC	2 cut(s)	172, 482
PflMI	CCANNNNNTGG	1 cut(s)	501
PkrI	GCNGC	2 cut(s)	453, 677
PleI	GAGTC	2 cut(s)	934, 972
PpsI	GAGTC	2 cut(s)	934, 972
PpuMI	RGGWCCY	1 cut(s)	620
PscI	ACATGT	1 cut(s)	987
PshBI	ATTAAT	1 cut(s)	759
PsiI	TTATAA	2 cut(s)	152, 423
Psp5II	RGGWCCY	1 cut(s)	620
Psp6I	CCWGG	3 cut(s)	851, 1240, 1288
PspFI	CCCAGC	1 cut(s)	832
PspGI	CCWGG	3 cut(s)	851, 1240, 1288
PspN4I	GGNNCC	2 cut(s)	62, 1239
PspPI	GGNCC	2 cut(s)	60, 620
PspPPI	RGGWCCY	1 cut(s)	620
PstI	CTGCAG	1 cut(s)	680
PstNI	CAGNNNCTG	1 cut(s)	741
PsuI	RGATCY	2 cut(s)	124, 289
SaqAI	TTAA	3 cut(s)	285, 759, 1098
SatI	GCNGC	2 cut(s)	452, 676
Sau3AI	GATC	4 cut(s)	124, 250, 289, 976
Sau96I	GGNCC	2 cut(s)	60, 620
SchI	GAGTC	2 cut(s)	934, 973
ScrFI	CCNGG	3 cut(s)	853, 1242, 1290
SfaNI	GCATC	1 cut(s)	1018
SfcI	CTRYAG	1 cut(s)	676
SinI	GGWCC	2 cut(s)	60, 620
SmlI	CTYRAG	2 cut(s)	640, 905
SmoI	CTYRAG	2 cut(s)	640, 905
Sse9I	AATT	5 cut(s)	79, 372, 499, 541, 1126
SspMI	CTAG	3 cut(s)	122, 600, 804
StyD4I	CCNGG	3 cut(s)	851, 1240, 1288
StyI	CCWWGG	3 cut(s)	591, 803, 1156
TaaI	ACNGT	1 cut(s)	74
TaqI	TCGA	1 cut(s)	938
TasI	AATT	5 cut(s)	79, 372, 499, 541, 1126
TfiI	GAWTC	2 cut(s)	172, 482
Tru1I	TTAA	3 cut(s)	285, 759, 1098
Tru9I	TTAA	3 cut(s)	285, 759, 1098
TscAI	CASTG	4 cut(s)	79, 95, 447, 746
TseI	GCWGC	2 cut(s)	451, 675
TspDTI	ATGAA	5 cut(s)	236, 301, 720, 744, 1139
TspRI	CASTG	4 cut(s)	79, 95, 447, 746
Van91I	CCANNNNNTGG	1 cut(s)	501
VpaK11BI	GGWCC	2 cut(s)	60, 620
VspI	ATTAAT	1 cut(s)	759
XapI	RAATTY	1 cut(s)	1126
XbaI	TCTAGA	1 cut(s)	599
XceI	RCATGY	1 cut(s)	991
XcmI	CCANNNNNNNNNTGG	2 cut(s)	859, 1214
XmaJI	CCTAGG	1 cut(s)	803
XmnI	GAANNNNTTC	1 cut(s)	926
XspI	CTAG	3 cut(s)	122, 600, 804

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.