Rmu_sc0011992.1_g000011

Encoded by

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0011992.1
Physical Location & Seq
Reverse (-)
40186 .. 40458
273 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0011992.1_g000011.1.cds

Sequence Viewer

Length: 273 bp
atggatatctcaccacagcttttgcagtacagatatcactttggaattgcaatcttcgtttcattagtcttttccttgctgttatatgcagcccctcggattctaaccattctgagttacttttggcctctcctggcctccacaactctgtttttggtggcgataatcgcctttggtggtgtttcgaagctgtcaaccgaagttcatggtgaaacgcaaggtcaaggaatcattgattatgttgctggccgcccagactacctagatgattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

90

Amino Acids

10.01

Weight (kDa)

5.0

Isoelectric Point (pI)

24.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016551)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G16400
fragaria_vesca FvH4_3g00490
malus_domestica MD00G1056900.v1.1
prunus_persica Prupe.4G005500_v2.0.a1
pyrus_communis pycom05g32680
rosa_chinensis RchiOBHm_Chr5g0000661
rosa_multiflora Rmu_sc0011992.1_g000011
rosa_roxburghii Rroxscaffold_1G00075540
rosa_rugosa Rorug04G0385600
rosa_samantha Rh5AG005700 Rh5BG007300 Rh5CG006100 Rh5DG005900
rosa_wichuraiana Rw5G000560

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 250
AcoI YGGCCR 1 cut(s) 247
AfaI GTAC 1 cut(s) 29
AjnI CCWGG 1 cut(s) 132
AluBI AGCT 2 cut(s) 19, 190
AluI AGCT 2 cut(s) 19, 190
AoxI GGCC 3 cut(s) 125, 135, 247
ApeKI GCWGC 1 cut(s) 89
AsuHPI GGTGA 2 cut(s) 3, 221
AsuII TTCGAA 1 cut(s) 185
BbvI GCAGC 1 cut(s) 101
BciT130I CCWGG 1 cut(s) 134
BfaI CTAG 1 cut(s) 263
BisI GCNGC 2 cut(s) 90, 250
BlsI GCNGC 2 cut(s) 91, 251
Bme1390I CCNGG 1 cut(s) 134
BmrFI CCNGG 1 cut(s) 134
Bpu14I TTCGAA 1 cut(s) 185
BsaJI CCNNGG 1 cut(s) 95
BseBI CCWGG 1 cut(s) 134
BseDI CCNNGG 1 cut(s) 95
BseMII CTCAG 1 cut(s) 104
BseXI GCAGC 1 cut(s) 101
BshFI GGCC 3 cut(s) 127, 137, 249
BsnI GGCC 3 cut(s) 127, 137, 249
Bsp119I TTCGAA 1 cut(s) 185
BspACI CCGC 1 cut(s) 250
BspANI GGCC 3 cut(s) 127, 137, 249
BspCNI CTCAG 1 cut(s) 105
BspT104I TTCGAA 1 cut(s) 185
BssECI CCNNGG 1 cut(s) 95
Bst2UI CCWGG 1 cut(s) 134
BstBI TTCGAA 1 cut(s) 185
BstC8I GCNNGC 1 cut(s) 247
BstDEI CTNAG 1 cut(s) 113
BstMWI GCNNNNNNNGC 1 cut(s) 167
BstNI CCWGG 1 cut(s) 134
BstSCI CCNGG 1 cut(s) 132
BstV1I GCAGC 1 cut(s) 101
BsuRI GGCC 3 cut(s) 127, 137, 249
Cac8I GCNNGC 1 cut(s) 247
Csp6I GTAC 1 cut(s) 28
CspCI CAANNNNNGTGG 1 cut(s) 38
CviAII CATG 1 cut(s) 206
CviJI RGCY 6 cut(s) 19, 92, 127, 137, 190, 249
CviKI_1 RGCY 6 cut(s) 19, 92, 127, 137, 190, 249
CviQI GTAC 1 cut(s) 28
DdeI CTNAG 1 cut(s) 113
EaeI YGGCCR 1 cut(s) 247
Eco32I GATATC 2 cut(s) 7, 35
EcoRII CCWGG 1 cut(s) 132
EcoRV GATATC 2 cut(s) 7, 35
FaeI CATG 1 cut(s) 209
FaiI YATR 4 cut(s) 85, 87, 207, 240
FatI CATG 1 cut(s) 205
Fnu4HI GCNGC 2 cut(s) 90, 250
Fsp4HI GCNGC 2 cut(s) 90, 250
FspBI CTAG 1 cut(s) 263
GluI GCNGC 2 cut(s) 90, 250
HaeIII GGCC 3 cut(s) 127, 137, 249
Hin1II CATG 1 cut(s) 209
HincII GTYRAC 1 cut(s) 195
HindII GTYRAC 1 cut(s) 195
HinfI GANTC 2 cut(s) 100, 228
HphI GGTGA 2 cut(s) 3, 221
Hpy166II GTNNAC 1 cut(s) 195
Hpy188I TCNGA 2 cut(s) 99, 114
Hpy8I GTNNAC 1 cut(s) 195
HpyCH4V TGCA 3 cut(s) 25, 50, 89
HpyF10VI GCNNNNNNNGC 1 cut(s) 167
HpyF3I CTNAG 1 cut(s) 113
Hsp92II CATG 1 cut(s) 209
LpnPI CCDG 4 cut(s) 119, 146, 231, 267
Lsp1109I GCAGC 1 cut(s) 101
MaeI CTAG 1 cut(s) 263
MaeIII GTNAC 1 cut(s) 116
MboII GAAGA 1 cut(s) 46
MluCI AATT 1 cut(s) 45
MnlI CCTC 3 cut(s) 105, 138, 148
MspR9I CCNGG 1 cut(s) 134
MvaI CCWGG 1 cut(s) 134
MwoI GCNNNNNNNGC 1 cut(s) 167
NlaIII CATG 1 cut(s) 209
NspV TTCGAA 1 cut(s) 185
PfeI GAWTC 2 cut(s) 100, 228
PkrI GCNGC 2 cut(s) 91, 251
Psp6I CCWGG 1 cut(s) 132
PspGI CCWGG 1 cut(s) 132
RsaI GTAC 1 cut(s) 29
RsaNI GTAC 1 cut(s) 28
SatI GCNGC 2 cut(s) 90, 250
ScrFI CCNGG 1 cut(s) 134
SetI ASST 4 cut(s) 21, 192, 223, 264
SfuI TTCGAA 1 cut(s) 185
SgeI CNNG 9 cut(s) 88, 108, 145, 146, 218, 230, 236, 258, 266
Sse9I AATT 1 cut(s) 45
SsiI CCGC 1 cut(s) 250
SspMI CTAG 1 cut(s) 263
StyD4I CCNGG 1 cut(s) 132
TaqI TCGA 1 cut(s) 185
TasI AATT 1 cut(s) 45
TatI WGTACW 1 cut(s) 27
TauI GCSGC 1 cut(s) 252
TfiI GAWTC 2 cut(s) 100, 228
TseI GCWGC 1 cut(s) 89
TspDTI ATGAA 2 cut(s) 51, 194
XspI CTAG 1 cut(s) 263
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.