Rmu_sc0012148.1_g000002

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0012148.1
Physical Location & Seq
Forward (+)
9301 .. 9801
501 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0012148.1_g000002.1.cds

Sequence Viewer

Length: 501 bp
atggttcagaagcttgaagctataaagggtggtggaggatccatcagggtaggggccactgggacagtcagttccctaatgacaagagaactagactccatcaaggttgaacctccgatgcctatagcttcttcccgaattaaacatcaaacagctcctgtttctgttccatgtggtgttcctactccaaaaaagctaccaaggaagtcatctgacgaagccagcagcagtggaagcagcaaccacatgaatcagagacaccctgacattccccagaaaccgaaaactcatctgaaaactactagtcaaatcccgatgctcgactctcataatattggtatggataaaactcctattaggcagaaagctaacaagaaaggacctaatatcgttgaagttgtggacatcaaatgtgggggctcgggtagagcgtgggctggccctgtaacgaatcggctcaagaagctgagcttctcaaagctctctgagagtgttgtctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

166

Amino Acids

17.72

Weight (kDa)

10.2

Isoelectric Point (pI)

33.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012532)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 33, 46
AgsI TTSAA 3 cut(s) 17, 110, 395
AhlI ACTAGT 1 cut(s) 302
AloI GAACNNNNNNTCC 2 cut(s) 55, 87
AluBI AGCT 9 cut(s) 13, 20, 128, 155, 196, 368, 466, 471, 481
AluI AGCT 9 cut(s) 13, 20, 128, 155, 196, 368, 466, 471, 481
Alw26I GTCTC 1 cut(s) 250
AlwI GGATC 2 cut(s) 33, 46
AlwNI CAGNNNCTG 1 cut(s) 158
Ama87I CYCGRG 1 cut(s) 421
AoxI GGCC 2 cut(s) 54, 439
ApeKI GCWGC 2 cut(s) 225, 237
AspS9I GGNCC 3 cut(s) 54, 380, 440
AvaI CYCGRG 1 cut(s) 421
AvaII GGWCC 1 cut(s) 380
BamHI GGATCC 1 cut(s) 38
BanII GRGCYC 1 cut(s) 422
BbvI GCAGC 2 cut(s) 237, 249
BccI CCATC 2 cut(s) 50, 107
BcoDI GTCTC 1 cut(s) 250
BcuI ACTAGT 1 cut(s) 302
BfaI CTAG 2 cut(s) 92, 303
BfmI CTRYAG 1 cut(s) 123
BisI GCNGC 2 cut(s) 226, 238
BlpI GCTNAGC 1 cut(s) 467
BlsI GCNGC 2 cut(s) 227, 239
Bme18I GGWCC 1 cut(s) 380
BmeT110I CYCGRG 1 cut(s) 421
BmgT120I GGNCC 3 cut(s) 54, 380, 440
BmiI GGNNCC 2 cut(s) 40, 55
BmrI ACTGGG 1 cut(s) 69
BmsI GCATC 2 cut(s) 108, 306
BmuI ACTGGG 1 cut(s) 69
Bpu1102I GCTNAGC 1 cut(s) 467
BpuEI CTTGAG 1 cut(s) 443
BsaJI CCNNGG 1 cut(s) 200
Bse1I ACTGG 1 cut(s) 64
BseDI CCNNGG 1 cut(s) 200
BseMII CTCAG 2 cut(s) 458, 477
BseNI ACTGG 1 cut(s) 64
BseXI GCAGC 2 cut(s) 237, 249
BshFI GGCC 2 cut(s) 56, 441
BsiHKCI CYCGRG 1 cut(s) 421
BslFI GGGAC 1 cut(s) 76
BsmAI GTCTC 1 cut(s) 250
BsmFI GGGAC 1 cut(s) 76
BsnI GGCC 2 cut(s) 56, 441
BsoBI CYCGRG 1 cut(s) 421
Bsp1286I GDGCHC 1 cut(s) 422
Bsp143I GATC 1 cut(s) 38
Bsp1720I GCTNAGC 1 cut(s) 467
BspANI GGCC 2 cut(s) 56, 441
BspCNI CTCAG 2 cut(s) 459, 478
BspLI GGNNCC 2 cut(s) 40, 55
BspPI GGATC 2 cut(s) 33, 46
BsrI ACTGG 1 cut(s) 64
BssECI CCNNGG 1 cut(s) 200
BssMI GATC 1 cut(s) 38
BssT1I CCWWGG 1 cut(s) 200
Bst4CI ACNGT 1 cut(s) 67
BstC8I GCNNGC 2 cut(s) 223, 439
BstDEI CTNAG 2 cut(s) 467, 486
BstKTI GATC 1 cut(s) 41
BstMAI GTCTC 1 cut(s) 250
BstMBI GATC 1 cut(s) 38
BstMWI GCNNNNNNNGC 2 cut(s) 234, 463
BstSFI CTRYAG 1 cut(s) 123
BstV1I GCAGC 2 cut(s) 237, 249
BstX2I RGATCY 1 cut(s) 38
BstYI RGATCY 1 cut(s) 38
BsuRI GGCC 2 cut(s) 56, 441
BtsI GCAGTG 1 cut(s) 235
BtsIMutI CAGTG 2 cut(s) 57, 235
Cac8I GCNNGC 2 cut(s) 223, 439
CaiI CAGNNNCTG 1 cut(s) 158
Cfr13I GGNCC 3 cut(s) 54, 380, 440
CviAII CATG 2 cut(s) 171, 247
DdeI CTNAG 2 cut(s) 467, 486
DpnI GATC 1 cut(s) 40
DpnII GATC 1 cut(s) 38
Eco130I CCWWGG 1 cut(s) 200
Eco24I GRGCYC 1 cut(s) 422
Eco47I GGWCC 1 cut(s) 380
Eco88I CYCGRG 1 cut(s) 421
EcoO109I RGGNCCY 1 cut(s) 380
EcoT14I CCWWGG 1 cut(s) 200
EcoT38I GRGCYC 1 cut(s) 422
ErhI CCWWGG 1 cut(s) 200
FaeI CATG 2 cut(s) 174, 250
FaiI YATR 6 cut(s) 23, 125, 172, 248, 330, 341
FalI AAGNNNNNCTT 2 cut(s) 455, 487
FaqI GGGAC 1 cut(s) 76
FatI CATG 2 cut(s) 170, 246
Fnu4HI GCNGC 2 cut(s) 226, 238
FriOI GRGCYC 1 cut(s) 422
Fsp4HI GCNGC 2 cut(s) 226, 238
FspBI CTAG 2 cut(s) 92, 303
GluI GCNGC 2 cut(s) 226, 238
HaeIII GGCC 2 cut(s) 56, 441
Hin1II CATG 2 cut(s) 174, 250
HindIII AAGCTT 1 cut(s) 11
HinfI GANTC 4 cut(s) 95, 250, 323, 451
Hpy166II GTNNAC 1 cut(s) 403
Hpy188I TCNGA 6 cut(s) 9, 117, 214, 255, 294, 487
Hpy188III TCNNGA 3 cut(s) 135, 313, 460
Hpy8I GTNNAC 1 cut(s) 403
HpyCH4III ACNGT 1 cut(s) 67
HpyF10VI GCNNNNNNNGC 2 cut(s) 234, 463
HpyF3I CTNAG 2 cut(s) 467, 486
Hsp92II CATG 2 cut(s) 174, 250
Kzo9I GATC 1 cut(s) 38
LmnI GCTCC 1 cut(s) 160
LpnPI CCDG 8 cut(s) 31, 45, 171, 235, 276, 287, 423, 456
Lsp1109I GCAGC 2 cut(s) 237, 249
LweI GCATC 2 cut(s) 108, 306
MaeI CTAG 2 cut(s) 92, 303
MaeIII GTNAC 1 cut(s) 445
MalI GATC 1 cut(s) 40
MboI GATC 1 cut(s) 38
MboII GAAGA 1 cut(s) 123
MflI RGATCY 1 cut(s) 38
MhlI GDGCHC 1 cut(s) 422
MluCI AATT 1 cut(s) 138
MlyI GAGTC 2 cut(s) 89, 317
MnlI CCTC 2 cut(s) 29, 123
MseI TTAA 1 cut(s) 141
MwoI GCNNNNNNNGC 2 cut(s) 234, 463
NdeII GATC 1 cut(s) 38
NlaIII CATG 2 cut(s) 174, 250
NlaIV GGNNCC 2 cut(s) 40, 55
PcsI WCGNNNNNNNCGW 1 cut(s) 428
PfeI GAWTC 2 cut(s) 250, 451
PkrI GCNGC 2 cut(s) 227, 239
PleI GAGTC 2 cut(s) 89, 317
PpsI GAGTC 2 cut(s) 89, 317
PpuMI RGGWCCY 1 cut(s) 380
Psp5II RGGWCCY 1 cut(s) 380
PspN4I GGNNCC 2 cut(s) 40, 55
PspPI GGNCC 3 cut(s) 54, 380, 440
PspPPI RGGWCCY 1 cut(s) 380
PstNI CAGNNNCTG 1 cut(s) 158
PsuI RGATCY 1 cut(s) 38
SaqAI TTAA 1 cut(s) 141
SatI GCNGC 2 cut(s) 226, 238
Sau3AI GATC 1 cut(s) 38
Sau96I GGNCC 3 cut(s) 54, 380, 440
SchI GAGTC 2 cut(s) 89, 317
SduI GDGCHC 1 cut(s) 422
SfaNI GCATC 2 cut(s) 108, 306
SfcI CTRYAG 1 cut(s) 123
SinI GGWCC 1 cut(s) 380
SmlI CTYRAG 1 cut(s) 458
SmoI CTYRAG 1 cut(s) 458
SpeI ACTAGT 1 cut(s) 302
Sse9I AATT 1 cut(s) 138
SspI AATATT 1 cut(s) 334
SspMI CTAG 2 cut(s) 92, 303
StyI CCWWGG 1 cut(s) 200
TaaI ACNGT 1 cut(s) 67
TaqI TCGA 1 cut(s) 321
TasI AATT 1 cut(s) 138
TfiI GAWTC 2 cut(s) 250, 451
Tru1I TTAA 1 cut(s) 141
Tru9I TTAA 1 cut(s) 141
TscAI CASTG 2 cut(s) 64, 235
TseI GCWGC 2 cut(s) 225, 237
TspDTI ATGAA 1 cut(s) 263
TspRI CASTG 2 cut(s) 64, 235
VpaK11BI GGWCC 1 cut(s) 380
XspI CTAG 2 cut(s) 92, 303
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.