Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0012959.1

Orthogroup ID

OG0014226

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 1232

Gene Structure 1232 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0012959.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 352 bp

atatctggttgcagtcacggcagctgtcacggttcattcatttctgcaactactgataaatggatctaggctgctgagaaagtctccgatgattccctcaaggaatcatgcctggcttagctttgctggggatcaggtatttgcatatgcaatgatgagcgcagggtcagctgcatccggagtaagcaacctgaatcgcacaggaatccggcacacacctctcccgaatttctgtaaaccactaaatatcttctgcgaccacattgccatctcgataggcttcactttcttaagctgcctcttgctggccacatctgcagttcagaatgtaatctggctctcccacaactga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005488 GO:0048037 GO:0051536 GO:0051540

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF588

Protein Analysis

116

Amino Acids

12.59

Weight (kDa)

9.75

Isoelectric Point (pI)

43.69

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014226)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G79780 AT3G16300
fragaria_vesca	FvH4_6g32160
malus_domestica	MD09G1205900.v1.1
prunus_persica	Prupe.3G061300_v2.0.a1 Prupe.3G065500_v2.0.a1
pyrus_communis	pycom09g12270
rosa_chinensis	RchiOBHm_Chr2g0140051
rosa_multiflora	Rmu_sc0003365.1_g000011 Rmu_sc0012959.1_g000001
rosa_roxburghii	Rroxscaffold_2G00105110
rosa_rugosa	Rorug02G0360800
rosa_samantha	Rh2AG411400 Rh2BG421600 Rh2CG397500 Rh2DG431100
rosa_wichuraiana	Rw2G033700

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccIII	TCCGGA	1 cut(s)	177
AclWI	GGATC	2 cut(s)	71, 139
AcoI	YGGCCR	1 cut(s)	307
AcsI	RAATTY	1 cut(s)	227
AfiI	CCNNNNNNNGG	1 cut(s)	305
AflII	CTTAAG	1 cut(s)	290
AjnI	CCWGG	1 cut(s)	111
AluBI	AGCT	4 cut(s)	24, 121, 171, 295
AluI	AGCT	4 cut(s)	24, 121, 171, 295
Alw26I	GTCTC	1 cut(s)	88
AlwI	GGATC	2 cut(s)	71, 139
Aor13HI	TCCGGA	1 cut(s)	177
AoxI	GGCC	1 cut(s)	307
ApeKI	GCWGC	4 cut(s)	21, 71, 171, 295
ApoI	RAATTY	1 cut(s)	227
AspLEI	GCGC	1 cut(s)	162
BalI	TGGCCA	1 cut(s)	309
BbvI	GCAGC	4 cut(s)	33, 58, 158, 282
BccI	CCATC	1 cut(s)	276
BceAI	ACGGC	1 cut(s)	34
BcgI	CGANNNNNNTGC	2 cut(s)	246, 280
BciT130I	CCWGG	1 cut(s)	113
BcoDI	GTCTC	1 cut(s)	88
BfaI	CTAG	1 cut(s)	67
BfmI	CTRYAG	1 cut(s)	316
BfrI	CTTAAG	1 cut(s)	290
BisI	GCNGC	4 cut(s)	22, 72, 172, 296
BlpI	GCTNAGC	1 cut(s)	117
BlsI	GCNGC	4 cut(s)	23, 73, 173, 297
Bme1390I	CCNGG	1 cut(s)	113
BmrFI	CCNGG	1 cut(s)	113
BmsI	GCATC	1 cut(s)	183
BplI	GAGNNNNNCTC	2 cut(s)	68, 100
Bpu1102I	GCTNAGC	1 cut(s)	117
BpuEI	CTTGAG	1 cut(s)	83
BsaWI	WCCGGW	1 cut(s)	177
Bsc4I	CCNNNNNNNGG	1 cut(s)	305
Bse3DI	GCAATG	2 cut(s)	157, 262
BseAI	TCCGGA	1 cut(s)	177
BseBI	CCWGG	1 cut(s)	113
BseGI	GGATG	1 cut(s)	174
BseLI	CCNNNNNNNGG	1 cut(s)	305
BseMI	GCAATG	2 cut(s)	157, 262
BseMII	CTCAG	1 cut(s)	66
BseXI	GCAGC	4 cut(s)	33, 58, 158, 282
BseYI	CCCAGC	1 cut(s)	126
BshFI	GGCC	1 cut(s)	309
BsiSI	CCGG	2 cut(s)	178, 209
BslI	CCNNNNNNNGG	1 cut(s)	305
BsmAI	GTCTC	1 cut(s)	88
BsnI	GGCC	1 cut(s)	309
Bsp13I	TCCGGA	1 cut(s)	177
Bsp143I	GATC	2 cut(s)	63, 131
Bsp1720I	GCTNAGC	1 cut(s)	117
BspANI	GGCC	1 cut(s)	309
BspCNI	CTCAG	1 cut(s)	67
BspEI	TCCGGA	1 cut(s)	177
BspMAI	CTGCAG	1 cut(s)	320
BspPI	GGATC	2 cut(s)	71, 139
BspTI	CTTAAG	1 cut(s)	290
BsrDI	GCAATG	2 cut(s)	157, 262
BssMI	GATC	2 cut(s)	63, 131
Bst2UI	CCWGG	1 cut(s)	113
Bst4CI	ACNGT	1 cut(s)	32
BstAFI	CTTAAG	1 cut(s)	290
BstC8I	GCNNGC	1 cut(s)	307
BstDEI	CTNAG	2 cut(s)	75, 117
BstF5I	GGATG	1 cut(s)	174
BstHHI	GCGC	1 cut(s)	162
BstKTI	GATC	2 cut(s)	66, 134
BstMAI	GTCTC	1 cut(s)	88
BstMBI	GATC	2 cut(s)	63, 131
BstMWI	GCNNNNNNNGC	3 cut(s)	18, 168, 315
BstNI	CCWGG	1 cut(s)	113
BstSCI	CCNGG	1 cut(s)	111
BstSFI	CTRYAG	1 cut(s)	316
BstV1I	GCAGC	4 cut(s)	33, 58, 158, 282
BstX2I	RGATCY	1 cut(s)	63
BstYI	RGATCY	1 cut(s)	63
BsuRI	GGCC	1 cut(s)	309
BtsCI	GGATG	1 cut(s)	174
Cac8I	GCNNGC	1 cut(s)	307
CfoI	GCGC	1 cut(s)	162
CviAII	CATG	1 cut(s)	108
CviJI	RGCY	9 cut(s)	24, 71, 116, 121, 171, 280, 295, 309, 338
CviKI_1	RGCY	9 cut(s)	24, 71, 116, 121, 171, 280, 295, 309, 338
DdeI	CTNAG	2 cut(s)	75, 117
DpnI	GATC	2 cut(s)	65, 133
DpnII	GATC	2 cut(s)	63, 131
EaeI	YGGCCR	1 cut(s)	307
EcoRII	CCWGG	1 cut(s)	111
FaeI	CATG	1 cut(s)	111
FaiI	YATR	3 cut(s)	109, 146, 148
FatI	CATG	1 cut(s)	107
FauNDI	CATATG	1 cut(s)	146
Fnu4HI	GCNGC	4 cut(s)	22, 72, 172, 296
FokI	GGATG	1 cut(s)	161
Fsp4HI	GCNGC	4 cut(s)	22, 72, 172, 296
FspBI	CTAG	1 cut(s)	67
GlaI	GCGC	1 cut(s)	161
GluI	GCNGC	4 cut(s)	22, 72, 172, 296
GsaI	CCCAGC	1 cut(s)	130
HaeIII	GGCC	1 cut(s)	309
HapII	CCGG	2 cut(s)	178, 209
HhaI	GCGC	1 cut(s)	162
Hin1II	CATG	1 cut(s)	111
Hin6I	GCGC	1 cut(s)	160
HinP1I	GCGC	1 cut(s)	160
HinfI	GANTC	4 cut(s)	92, 104, 194, 205
HpaII	CCGG	2 cut(s)	178, 209
Hpy166II	GTNNAC	1 cut(s)	237
Hpy188I	TCNGA	2 cut(s)	88, 325
Hpy188III	TCNNGA	3 cut(s)	178, 224, 272
Hpy8I	GTNNAC	1 cut(s)	237
HpyCH4III	ACNGT	1 cut(s)	32
HpyCH4V	TGCA	6 cut(s)	12, 47, 144, 150, 174, 318
HpyF10VI	GCNNNNNNNGC	3 cut(s)	18, 168, 315
HpyF3I	CTNAG	2 cut(s)	75, 117
Hsp92II	CATG	1 cut(s)	111
HspAI	GCGC	1 cut(s)	160
Kpn2I	TCCGGA	1 cut(s)	177
Kzo9I	GATC	2 cut(s)	63, 131
Lsp1109I	GCAGC	4 cut(s)	33, 58, 158, 282
LweI	GCATC	1 cut(s)	183
MaeI	CTAG	1 cut(s)	67
MaeIII	GTNAC	2 cut(s)	14, 26
MalI	GATC	2 cut(s)	65, 133
MboI	GATC	2 cut(s)	63, 131
MboII	GAAGA	1 cut(s)	242
MflI	RGATCY	1 cut(s)	63
MlsI	TGGCCA	1 cut(s)	309
MluCI	AATT	1 cut(s)	227
MluNI	TGGCCA	1 cut(s)	309
MnlI	CCTC	3 cut(s)	107, 229, 309
Mox20I	TGGCCA	1 cut(s)	309
MroI	TCCGGA	1 cut(s)	177
MscI	TGGCCA	1 cut(s)	309
MseI	TTAA	1 cut(s)	291
Msp20I	TGGCCA	1 cut(s)	309
MspA1I	CMGCKG	2 cut(s)	24, 171
MspCI	CTTAAG	1 cut(s)	290
MspI	CCGG	2 cut(s)	178, 209
MspR9I	CCNGG	1 cut(s)	113
MvaI	CCWGG	1 cut(s)	113
MwoI	GCNNNNNNNGC	3 cut(s)	18, 168, 315
NdeI	CATATG	1 cut(s)	146
NdeII	GATC	2 cut(s)	63, 131
NlaIII	CATG	1 cut(s)	111
NmuCI	GTSAC	2 cut(s)	14, 26
PfeI	GAWTC	4 cut(s)	92, 104, 194, 205
PkrI	GCNGC	4 cut(s)	23, 73, 173, 297
Psp6I	CCWGG	1 cut(s)	111
PspFI	CCCAGC	1 cut(s)	126
PspGI	CCWGG	1 cut(s)	111
PstI	CTGCAG	1 cut(s)	320
PsuI	RGATCY	1 cut(s)	63
PvuII	CAGCTG	2 cut(s)	24, 171
SaqAI	TTAA	1 cut(s)	291
SatI	GCNGC	4 cut(s)	22, 72, 172, 296
Sau3AI	GATC	2 cut(s)	63, 131
ScrFI	CCNGG	1 cut(s)	113
SetI	ASST	7 cut(s)	26, 123, 139, 173, 193, 221, 297
SfaNI	GCATC	1 cut(s)	183
SfcI	CTRYAG	1 cut(s)	316
SmlI	CTYRAG	2 cut(s)	98, 290
SmoI	CTYRAG	2 cut(s)	98, 290
Sse9I	AATT	1 cut(s)	227
SspMI	CTAG	1 cut(s)	67
StyD4I	CCNGG	1 cut(s)	111
TaaI	ACNGT	1 cut(s)	32
TaqI	TCGA	1 cut(s)	273
TasI	AATT	1 cut(s)	227
TfiI	GAWTC	4 cut(s)	92, 104, 194, 205
Tru1I	TTAA	1 cut(s)	291
Tru9I	TTAA	1 cut(s)	291
TseFI	GTSAC	2 cut(s)	14, 26
TseI	GCWGC	4 cut(s)	21, 71, 171, 295
Tsp45I	GTSAC	2 cut(s)	14, 26
TspDTI	ATGAA	2 cut(s)	24, 28
Vha464I	CTTAAG	1 cut(s)	290
XapI	RAATTY	1 cut(s)	227
XspI	CTAG	1 cut(s)	67

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.