Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0013458.1

Orthogroup ID

OG0016413

Physical Location & Seq

Genomic Coordinates Reverse (-)

12671 .. 13042

Gene Structure 372 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0013458.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 372 bp

atgagtggagcggcgatcttcatcaaagacgacctccatatctccgacgtgcaggtcgaagttctagttggaattctgaatctctactccctcatcggatccgccgccaccggcaggacgtccgactggattggacgtcggtataccatagccctcgccggagccatcttcttcgctggatctcttctcatgggcttcgccaccaactactcgttcctcatgttcgggagatttgttgctggaattggcgtcggttatgccctcatgattgctcctgtctacaccgccgaagtttcttcggcgtcgtctcgtggtttcctcacgtcttttgctgatgtaggtttgtttgtttgtttctggcttgttagttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005215 GO:0005351 GO:0005354 GO:0005355 GO:0005365 GO:0005402 GO:0005575 GO:0005623 GO:0005886 GO:0006810 GO:0006811 GO:0006812 GO:0007275 GO:0008150 GO:0008324 GO:0008643 GO:0008645 GO:0009653 GO:0009791 GO:0010015 GO:0010101 GO:0010102 GO:0010311 GO:0015075 GO:0015077 GO:0015078 GO:0015144 GO:0015145 GO:0015146 GO:0015148 GO:0015149 GO:0015166 GO:0015168 GO:0015291 GO:0015293 GO:0015294 GO:0015295 GO:0015318 GO:0015575 GO:0015576 GO:0015591 GO:0015672 GO:0015749 GO:0015750 GO:0015752 GO:0015753 GO:0015757 GO:0015791 GO:0015793 GO:0015795 GO:0015797 GO:0015798 GO:0015850 GO:0016020 GO:0022622 GO:0022804 GO:0022857 GO:0022890 GO:0032501 GO:0032502 GO:0034219 GO:0034220 GO:0042995 GO:0044464 GO:0046323 GO:0048364 GO:0048527 GO:0048528 GO:0048646 GO:0048731 GO:0048856 GO:0051119 GO:0051179 GO:0051234 GO:0055085 GO:0071702 GO:0071944 GO:0090406 GO:0090696 GO:0090697 GO:0090698 GO:0098655 GO:0098660 GO:0098662 GO:0099402 GO:0120025 GO:1901618 GO:1902600 GO:1904659 GO:1905392 GO:1905393

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Sugar_tr

Protein Analysis

123

Amino Acids

13.08

Weight (kDa)

5.55

Isoelectric Point (pI)

21.32

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016413)

Species	Orthologous Gene IDs
malus_domestica	MD05G1068800.v1.1 MD05G1168300.v1.1
prunus_persica	Prupe.5G027100_v2.0.a1 Prupe.8G101500_v2.0.a1 Prupe.8G101500_v2.0.a1
pyrus_communis	pycom05g05980 pycom10g06260
rosa_chinensis	RchiOBHm_Chr6g0263611 RchiOBHm_Chr6g0263671
rosa_multiflora	Rmu_sc0013458.1_g000002
rosa_roxburghii	Rroxscaffold_176G00431120 Rroxscaffold_7G00204120
rosa_samantha	Rh6AG125100 Rh6BG121100 Rh6CG119400

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	53
AatII	GACGTC	2 cut(s)	122, 139
Acc36I	ACCTGC	1 cut(s)	43
AccBSI	CCGCTC	1 cut(s)	11
AccI	GTMKAC	2 cut(s)	143, 279
AciI	CCGC	4 cut(s)	11, 102, 105, 285
AclWI	GGATC	3 cut(s)	93, 106, 187
AcsI	RAATTY	1 cut(s)	72
AcyI	GRCGYC	4 cut(s)	119, 136, 249, 302
AfiI	CCNNNNNNNGG	1 cut(s)	114
AjiI	CACGTC	2 cut(s)	49, 324
AjuI	GAANNNNNNNTTGG	4 cut(s)	51, 83, 197, 229
Alw26I	GTCTC	1 cut(s)	312
AlwI	GGATC	3 cut(s)	93, 106, 187
ApoI	RAATTY	1 cut(s)	72
BamHI	GGATCC	1 cut(s)	98
BauI	CACGAG	1 cut(s)	309
BccI	CCATC	1 cut(s)	173
BcoDI	GTCTC	1 cut(s)	312
BfaI	CTAG	1 cut(s)	65
BfuAI	ACCTGC	1 cut(s)	43
BisI	GCNGC	2 cut(s)	12, 105
BlsI	GCNGC	2 cut(s)	13, 106
BmgBI	CACGTC	2 cut(s)	49, 324
BmiI	GGNNCC	2 cut(s)	100, 163
BsaBI	GATNNNNATC	1 cut(s)	20
BsaHI	GRCGYC	4 cut(s)	119, 136, 249, 302
Bsc4I	CCNNNNNNNGG	1 cut(s)	114
Bse118I	RCCGGY	1 cut(s)	110
Bse1I	ACTGG	1 cut(s)	131
Bse8I	GATNNNNATC	1 cut(s)	20
BseJI	GATNNNNATC	1 cut(s)	20
BseLI	CCNNNNNNNGG	1 cut(s)	114
BseNI	ACTGG	1 cut(s)	131
BsgI	GTGCAG	1 cut(s)	71
BsiSI	CCGG	2 cut(s)	111, 159
BslI	CCNNNNNNNGG	1 cut(s)	114
BsmAI	GTCTC	1 cut(s)	312
BsmBI	CGTCTC	1 cut(s)	312
Bsp143I	GATC	3 cut(s)	15, 98, 179
BspACI	CCGC	4 cut(s)	11, 102, 105, 285
BspHI	TCATGA	1 cut(s)	264
BspLI	GGNNCC	2 cut(s)	100, 163
BspMI	ACCTGC	1 cut(s)	43
BspPI	GGATC	3 cut(s)	93, 106, 187
BsrBI	CCGCTC	1 cut(s)	11
BsrFI	RCCGGY	1 cut(s)	110
BsrI	ACTGG	1 cut(s)	131
BssAI	RCCGGY	1 cut(s)	110
BssMI	GATC	3 cut(s)	15, 98, 179
BssNAI	GTATAC	1 cut(s)	144
BssNI	GRCGYC	4 cut(s)	119, 136, 249, 302
BssSI	CACGAG	1 cut(s)	309
Bst1107I	GTATAC	1 cut(s)	144
Bst2BI	CACGAG	1 cut(s)	309
Bst6I	CTCTTC	1 cut(s)	189
BstACI	GRCGYC	4 cut(s)	119, 136, 249, 302
BstKTI	GATC	3 cut(s)	18, 101, 182
BstMAI	GTCTC	1 cut(s)	312
BstMBI	GATC	3 cut(s)	15, 98, 179
BstX2I	RGATCY	2 cut(s)	98, 179
BstYI	RGATCY	2 cut(s)	98, 179
BstZ17I	GTATAC	1 cut(s)	144
BtrI	CACGTC	2 cut(s)	49, 324
BveI	ACCTGC	1 cut(s)	43
CciI	TCATGA	1 cut(s)	264
Cfr10I	RCCGGY	1 cut(s)	110
CseI	GACGC	2 cut(s)	238, 291
CviAII	CATG	3 cut(s)	190, 220, 265
CviJI	RGCY	4 cut(s)	152, 164, 195, 361
CviKI_1	RGCY	4 cut(s)	152, 164, 195, 361
DpnI	GATC	3 cut(s)	17, 100, 181
DpnII	GATC	3 cut(s)	15, 98, 179
DrdI	GACNNNNNNGTC	1 cut(s)	53
DseDI	GACNNNNNNGTC	1 cut(s)	53
Eam1104I	CTCTTC	1 cut(s)	189
EarI	CTCTTC	1 cut(s)	189
EciI	GGCGGA	1 cut(s)	91
EcoRI	GAATTC	1 cut(s)	72
Esp3I	CGTCTC	1 cut(s)	312
FaeI	CATG	3 cut(s)	193, 223, 268
FaiI	YATR	7 cut(s)	39, 144, 149, 191, 221, 258, 266
FatI	CATG	3 cut(s)	189, 219, 264
FblI	GTMKAC	2 cut(s)	143, 279
Fnu4HI	GCNGC	2 cut(s)	12, 105
Fsp4HI	GCNGC	2 cut(s)	12, 105
FspBI	CTAG	1 cut(s)	65
GluI	GCNGC	2 cut(s)	12, 105
HapII	CCGG	2 cut(s)	111, 159
HgaI	GACGC	2 cut(s)	238, 291
Hin1I	GRCGYC	4 cut(s)	119, 136, 249, 302
Hin1II	CATG	3 cut(s)	193, 223, 268
HinfI	GANTC	1 cut(s)	79
HpaII	CCGG	2 cut(s)	111, 159
Hpy166II	GTNNAC	2 cut(s)	144, 280
Hpy188I	TCNGA	4 cut(s)	46, 78, 98, 124
Hpy188III	TCNNGA	2 cut(s)	226, 265
Hpy8I	GTNNAC	2 cut(s)	144, 280
Hpy99I	CGWCG	4 cut(s)	50, 141, 254, 307
HpyCH4IV	ACGT	4 cut(s)	48, 119, 136, 323
HpyCH4V	TGCA	1 cut(s)	52
HpySE526I	ACGT	4 cut(s)	48, 119, 136, 323
Hsp92I	GRCGYC	4 cut(s)	119, 136, 249, 302
Hsp92II	CATG	3 cut(s)	193, 223, 268
Kzo9I	GATC	3 cut(s)	15, 98, 179
LmnI	GCTCC	3 cut(s)	8, 161, 277
LpnPI	CCDG	9 cut(s)	38, 100, 112, 124, 162, 172, 225, 288, 343
MaeI	CTAG	1 cut(s)	65
MaeII	ACGT	4 cut(s)	48, 119, 136, 323
MalI	GATC	3 cut(s)	17, 100, 181
MbiI	CCGCTC	1 cut(s)	11
MboI	GATC	3 cut(s)	15, 98, 179
MboII	GAAGA	5 cut(s)	10, 160, 163, 176, 288
MflI	RGATCY	2 cut(s)	98, 179
MluCI	AATT	2 cut(s)	72, 243
MmeI	TCCRAC	3 cut(s)	49, 69, 147
MnlI	CCTC	6 cut(s)	44, 101, 164, 227, 272, 329
MseI	TTAA	1 cut(s)	370
MspI	CCGG	2 cut(s)	111, 159
NdeII	GATC	3 cut(s)	15, 98, 179
NlaIII	CATG	3 cut(s)	193, 223, 268
NlaIV	GGNNCC	2 cut(s)	100, 163
PagI	TCATGA	1 cut(s)	264
PcsI	WCGNNNNNNNCGW	1 cut(s)	54
PfeI	GAWTC	1 cut(s)	79
PkrI	GCNGC	2 cut(s)	13, 106
PspN4I	GGNNCC	2 cut(s)	100, 163
PsuI	RGATCY	2 cut(s)	98, 179
SaqAI	TTAA	1 cut(s)	370
SatI	GCNGC	2 cut(s)	12, 105
Sau3AI	GATC	3 cut(s)	15, 98, 179
SetI	ASST	7 cut(s)	36, 51, 57, 122, 139, 326, 343
Sse9I	AATT	2 cut(s)	72, 243
SsiI	CCGC	4 cut(s)	11, 102, 105, 285
SspMI	CTAG	1 cut(s)	65
TaiI	ACGT	4 cut(s)	51, 122, 139, 326
TaqI	TCGA	1 cut(s)	57
TasI	AATT	2 cut(s)	72, 243
TauI	GCSGC	2 cut(s)	14, 107
TfiI	GAWTC	1 cut(s)	79
Tru1I	TTAA	1 cut(s)	370
Tru9I	TTAA	1 cut(s)	370
TspDTI	ATGAA	1 cut(s)	10
XapI	RAATTY	1 cut(s)	72
XmiI	GTMKAC	2 cut(s)	143, 279
XspI	CTAG	1 cut(s)	65
ZraI	GACGTC	2 cut(s)	120, 137

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.