Rmu_sc0013705.1_g000001
TCP Family

assists the folding of proteins upon ATP hydrolysis

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0013705.1
Physical Location & Seq
Forward (+)
3356 .. 4716
1361 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0013705.1_g000001.1.cds

Sequence Viewer

Length: 285 bp
atggaacggttggttttggcttgtggaggggaggcagtgaactctgaagatgatttaactcctgattgccttggctgggctggacttgtatatgagcatgtccttggtgaagagaagtacacatttgtcgaaaatgtgaagaaccctcattcttgcacaatcttaatcaaaggtattcagtacatcgctctgttgacagaagatttactaaatgtgaaagagttcctcgacttagtaaagctcaacttgcctgacggtctgggaactggttctggggcattttga

Protein Analysis

94

Amino Acids

10.24

Weight (kDa)

4.36

Isoelectric Point (pI)

26.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019841)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 66
AfaI GTAC 2 cut(s) 119, 182
AfiI CCNNNNNNNGG 1 cut(s) 76
AluBI AGCT 1 cut(s) 241
AluI AGCT 1 cut(s) 241
Asp700I GAANNNNTTC 2 cut(s) 221, 268
AsuHPI GGTGA 1 cut(s) 119
BsaJI CCNNGG 2 cut(s) 70, 103
Bsc4I CCNNNNNNNGG 1 cut(s) 76
Bse1I ACTGG 1 cut(s) 271
BseDI CCNNGG 2 cut(s) 70, 103
BseLI CCNNNNNNNGG 1 cut(s) 76
BseNI ACTGG 1 cut(s) 271
BseYI CCCAGC 1 cut(s) 75
BslI CCNNNNNNNGG 1 cut(s) 76
BsrI ACTGG 1 cut(s) 271
BssECI CCNNGG 2 cut(s) 70, 103
BssT1I CCWWGG 2 cut(s) 70, 103
Bst4CI ACNGT 2 cut(s) 9, 257
Bst6I CTCTTC 1 cut(s) 105
BstDEI CTNAG 1 cut(s) 232
BstMWI GCNNNNNNNGC 1 cut(s) 247
BstNSI RCATGY 1 cut(s) 101
BtgZI GCGATG 1 cut(s) 169
BtsI GCAGTG 1 cut(s) 42
BtsIMutI CAGTG 1 cut(s) 42
Csp6I GTAC 2 cut(s) 118, 181
CviAII CATG 1 cut(s) 98
CviJI RGCY 4 cut(s) 20, 75, 80, 241
CviKI_1 RGCY 4 cut(s) 20, 75, 80, 241
CviQI GTAC 2 cut(s) 118, 181
DdeI CTNAG 1 cut(s) 232
Eam1104I CTCTTC 1 cut(s) 105
EarI CTCTTC 1 cut(s) 105
Eco130I CCWWGG 2 cut(s) 70, 103
Eco57I CTGAAG 1 cut(s) 66
EcoT14I CCWWGG 2 cut(s) 70, 103
ErhI CCWWGG 2 cut(s) 70, 103
FaeI CATG 1 cut(s) 101
FaiI YATR 3 cut(s) 91, 93, 99
FalI AAGNNNNNCTT 2 cut(s) 230, 262
FatI CATG 1 cut(s) 97
GsaI CCCAGC 1 cut(s) 79
Hin1II CATG 1 cut(s) 101
HincII GTYRAC 1 cut(s) 195
HindII GTYRAC 1 cut(s) 195
HphI GGTGA 1 cut(s) 119
Hpy166II GTNNAC 3 cut(s) 40, 120, 195
Hpy188I TCNGA 1 cut(s) 46
Hpy188III TCNNGA 1 cut(s) 62
Hpy8I GTNNAC 3 cut(s) 40, 120, 195
HpyCH4III ACNGT 2 cut(s) 9, 257
HpyCH4V TGCA 1 cut(s) 156
HpyF10VI GCNNNNNNNGC 1 cut(s) 247
HpyF3I CTNAG 1 cut(s) 232
Hsp92II CATG 1 cut(s) 101
LpnPI CCDG 7 cut(s) 61, 66, 75, 245, 252, 258, 264
MboII GAAGA 4 cut(s) 59, 122, 151, 212
MnlI CCTC 4 cut(s) 20, 25, 156, 236
MroXI GAANNNNTTC 2 cut(s) 221, 268
MseI TTAA 2 cut(s) 56, 164
MwoI GCNNNNNNNGC 1 cut(s) 247
NlaIII CATG 1 cut(s) 101
NspI RCATGY 1 cut(s) 101
PdmI GAANNNNTTC 2 cut(s) 221, 268
PspFI CCCAGC 1 cut(s) 75
RsaI GTAC 2 cut(s) 119, 182
RsaNI GTAC 2 cut(s) 118, 181
SaqAI TTAA 2 cut(s) 56, 164
SetI ASST 2 cut(s) 175, 243
StyI CCWWGG 2 cut(s) 70, 103
TaaI ACNGT 2 cut(s) 9, 257
TaqI TCGA 2 cut(s) 129, 228
TatI WGTACW 2 cut(s) 117, 180
Tru1I TTAA 2 cut(s) 56, 164
Tru9I TTAA 2 cut(s) 56, 164
TscAI CASTG 1 cut(s) 42
TspRI CASTG 1 cut(s) 42
XceI RCATGY 1 cut(s) 101
XmnI GAANNNNTTC 2 cut(s) 221, 268
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.