Rh1AG008600
TCP Family

assists the folding of proteins upon ATP hydrolysis

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
OG0019841
Physical Location & Seq
Reverse (-)
1366746 .. 1367156
411 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG008600.1

Sequence Viewer

Length: 231 bp
ATGGAACGGTTGGTTTTGGCTTGTGGAGGGGAGGCAGTGAACTCTGTAGATGATTTAACTCCTGATTGCCTTGGCTGGGCTGGACTTGTATATGAGCACGTCCTTGGTGAAGAGAAGTACACATTTGTCGAAAATGTGAAGAACCCTCATTCTTGCACAATCTTAATCAAAGGGCCTAATGATCATACAATTGCCCAGATTAAGGATGCTGTTCTTATTTACTCTAATTAA

Protein Analysis

76

Amino Acids

8.33

Weight (kDa)

4.7

Isoelectric Point (pI)

22.33

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cpn60_TCP1 PF00118 1 - 71 7.3e-22 TCP-1/cpn60 chaperonin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019841)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0314091
rosa_multiflora Rmu_sc0013705.1_g000001
rosa_samantha Rh1AG008600 Rh2AG481300 Rh2CG467700 Rh3CG365700 Rh6AG127200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 119
AfiI CCNNNNNNNGG 2 cut(s) 76, 202
AjiI CACGTC 1 cut(s) 100
Alw21I GWGCWC 1 cut(s) 99
AoxI GGCC 1 cut(s) 173
AspS9I GGNCC 1 cut(s) 173
AsuHPI GGTGA 1 cut(s) 119
Bbv12I GWGCWC 1 cut(s) 99
BclI TGATCA 1 cut(s) 181
BfmI CTRYAG 1 cut(s) 45
BmgBI CACGTC 1 cut(s) 100
BmgT120I GGNCC 1 cut(s) 173
BmsI GCATC 1 cut(s) 196
BsaJI CCNNGG 2 cut(s) 70, 103
Bsc4I CCNNNNNNNGG 2 cut(s) 76, 202
BseDI CCNNGG 2 cut(s) 70, 103
BseGI GGATG 1 cut(s) 211
BseLI CCNNNNNNNGG 2 cut(s) 76, 202
BseYI CCCAGC 1 cut(s) 75
BshFI GGCC 1 cut(s) 175
BsiHKAI GWGCWC 1 cut(s) 99
BslI CCNNNNNNNGG 2 cut(s) 76, 202
BsnI GGCC 1 cut(s) 175
Bsp1286I GDGCHC 1 cut(s) 99
Bsp143I GATC 1 cut(s) 181
BspANI GGCC 1 cut(s) 175
BssECI CCNNGG 2 cut(s) 70, 103
BssMI GATC 1 cut(s) 181
BssT1I CCWWGG 2 cut(s) 70, 103
Bst4CI ACNGT 1 cut(s) 9
Bst6I CTCTTC 1 cut(s) 105
BstF5I GGATG 1 cut(s) 211
BstKTI GATC 1 cut(s) 184
BstMBI GATC 1 cut(s) 181
BstSFI CTRYAG 1 cut(s) 45
BsuRI GGCC 1 cut(s) 175
BtrI CACGTC 1 cut(s) 100
BtsCI GGATG 1 cut(s) 211
BtsI GCAGTG 1 cut(s) 42
BtsIMutI CAGTG 1 cut(s) 42
Cfr13I GGNCC 1 cut(s) 173
Csp6I GTAC 1 cut(s) 118
CviJI RGCY 4 cut(s) 20, 75, 80, 175
CviKI_1 RGCY 4 cut(s) 20, 75, 80, 175
CviQI GTAC 1 cut(s) 118
DpnI GATC 1 cut(s) 183
DpnII GATC 1 cut(s) 181
Eam1104I CTCTTC 1 cut(s) 105
EarI CTCTTC 1 cut(s) 105
Eco130I CCWWGG 2 cut(s) 70, 103
EcoO109I RGGNCCY 1 cut(s) 173
EcoT14I CCWWGG 2 cut(s) 70, 103
ErhI CCWWGG 2 cut(s) 70, 103
FaiI YATR 3 cut(s) 91, 93, 186
FbaI TGATCA 1 cut(s) 181
FokI GGATG 1 cut(s) 218
GsaI CCCAGC 1 cut(s) 79
HaeIII GGCC 1 cut(s) 175
HphI GGTGA 1 cut(s) 119
Hpy166II GTNNAC 2 cut(s) 40, 120
Hpy188III TCNNGA 1 cut(s) 62
Hpy8I GTNNAC 2 cut(s) 40, 120
HpyCH4III ACNGT 1 cut(s) 9
HpyCH4IV ACGT 1 cut(s) 99
HpyCH4V TGCA 1 cut(s) 156
HpySE526I ACGT 1 cut(s) 99
Ksp22I TGATCA 1 cut(s) 181
Kzo9I GATC 1 cut(s) 181
LpnPI CCDG 4 cut(s) 61, 66, 75, 209
LweI GCATC 1 cut(s) 196
MaeII ACGT 1 cut(s) 99
MalI GATC 1 cut(s) 183
MboI GATC 1 cut(s) 181
MboII GAAGA 2 cut(s) 122, 151
MfeI CAATTG 1 cut(s) 189
MhlI GDGCHC 1 cut(s) 99
MluCI AATT 2 cut(s) 189, 226
MnlI CCTC 3 cut(s) 20, 25, 156
MseI TTAA 4 cut(s) 56, 164, 201, 229
MunI CAATTG 1 cut(s) 189
NdeII GATC 1 cut(s) 181
PspFI CCCAGC 1 cut(s) 75
PspPI GGNCC 1 cut(s) 173
RsaI GTAC 1 cut(s) 119
RsaNI GTAC 1 cut(s) 118
SaqAI TTAA 4 cut(s) 56, 164, 201, 229
Sau3AI GATC 1 cut(s) 181
Sau96I GGNCC 1 cut(s) 173
SduI GDGCHC 1 cut(s) 99
SetI ASST 1 cut(s) 102
SfaNI GCATC 1 cut(s) 196
SfcI CTRYAG 1 cut(s) 45
Sse9I AATT 2 cut(s) 189, 226
StyI CCWWGG 2 cut(s) 70, 103
TaaI ACNGT 1 cut(s) 9
TaiI ACGT 1 cut(s) 102
TaqI TCGA 1 cut(s) 129
TasI AATT 2 cut(s) 189, 226
TatI WGTACW 1 cut(s) 117
Tru1I TTAA 4 cut(s) 56, 164, 201, 229
Tru9I TTAA 4 cut(s) 56, 164, 201, 229
TscAI CASTG 1 cut(s) 42
TspRI CASTG 1 cut(s) 42
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.