Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0014136.1

Orthogroup ID

OG0006561

Physical Location & Seq

Genomic Coordinates Forward (+)

29071 .. 29745

Gene Structure 675 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0014136.1_g000007.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 435 bp

atgcagttacaagacgcggggtgctggacagatgctgctactttagctgccacccatttgaaaggatctgattatgcaagggtgttgctaagatgggctgcacacgtcctccgtgctgaacacaacatatggagggctctgattttgtatgttgcagctggtgcaatgcaaggggcattggcagcacttcgtgaggtccaacaacctgacactgccgctatgttcattcttgcttgccgagaaattcatgccaccatcatctctgaatcaggaaactctgatgatgaatccaaatctgcaatcaaggacaagctgccacacttgcctgggttgggaccagagaatgaagatgttattgcagtcggtgaatattttgggcaataccagagaaaattggtgcatctgtgcatggactcacagccatatgctgaatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

144

Amino Acids

15.8

Weight (kDa)

5.44

Isoelectric Point (pI)

44.5

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006561)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G33530 AT3G33530 AT3G33530 AT3G33530 AT3G33530
fragaria_vesca	FvH4_1g02820 FvH4_1g02820 FvH4_1g02820 FvH4_1g02820
malus_domestica	MD02G1028100.v1.1 MD15G1169800.v1.1
prunus_persica	Prupe.7G246700_v2.0.a1
pyrus_communis	pycom02g02310 pycom15g15140
rosa_chinensis	RchiOBHm_Chr2g0087941
rosa_laevigata	RLG00000015913
rosa_multiflora	Rmu_sc0013931.1_g000009 Rmu_sc0014136.1_g000007
rosa_roxburghii	Rroxscaffold_2G00153110
rosa_rugosa	Rorug01G0479800 Rorug01G0479900
rosa_samantha	Rh2AG034600 Rh2BG033600 Rh2CG034600 Rh2DG034300
rosa_wichuraiana	Rw2G002700

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	1 cut(s)	17
AciI	CCGC	2 cut(s)	17, 216
AclWI	GGATC	1 cut(s)	73
AcsI	RAATTY	1 cut(s)	243
AdeI	CACNNNGTG	1 cut(s)	191
AfiI	CCNNNNNNNGG	1 cut(s)	332
AflIII	ACRYGT	1 cut(s)	103
AgsI	TTSAA	1 cut(s)	61
AjiI	CACGTC	1 cut(s)	106
AjnI	CCWGG	1 cut(s)	325
AluBI	AGCT	3 cut(s)	47, 158, 313
AluI	AGCT	3 cut(s)	47, 158, 313
AlwI	GGATC	1 cut(s)	73
AlwNI	CAGNNNCTG	1 cut(s)	35
ApeKI	GCWGC	6 cut(s)	35, 47, 98, 155, 182, 313
ApoI	RAATTY	1 cut(s)	243
AspS9I	GGNCC	2 cut(s)	196, 335
AsuHPI	GGTGA	1 cut(s)	377
AvaII	GGWCC	2 cut(s)	196, 335
BanII	GRGCYC	1 cut(s)	139
BbvI	GCAGC	6 cut(s)	22, 34, 85, 167, 194, 300
BccI	CCATC	2 cut(s)	87, 263
BciT130I	CCWGG	1 cut(s)	327
BisI	GCNGC	7 cut(s)	36, 48, 99, 156, 183, 216, 314
BlsI	GCNGC	7 cut(s)	37, 49, 100, 157, 184, 217, 315
Bme1390I	CCNGG	1 cut(s)	327
Bme18I	GGWCC	2 cut(s)	196, 335
BmgBI	CACGTC	1 cut(s)	106
BmgT120I	GGNCC	2 cut(s)	196, 335
BmiI	GGNNCC	1 cut(s)	336
BmrFI	CCNGG	1 cut(s)	327
BmsI	GCATC	2 cut(s)	22, 409
BsaJI	CCNNGG	1 cut(s)	326
BsaXI	ACNNNNNCTCC	2 cut(s)	93, 123
Bsc4I	CCNNNNNNNGG	1 cut(s)	332
Bse3DI	GCAATG	1 cut(s)	171
BseBI	CCWGG	1 cut(s)	327
BseDI	CCNNGG	1 cut(s)	326
BseLI	CCNNNNNNNGG	1 cut(s)	332
BseMI	GCAATG	1 cut(s)	171
BseXI	GCAGC	6 cut(s)	22, 34, 85, 167, 194, 300
BsgI	GTGCAG	1 cut(s)	84
Bsh1236I	CGCG	1 cut(s)	17
BslFI	GGGAC	1 cut(s)	348
BslI	CCNNNNNNNGG	1 cut(s)	332
BsmFI	GGGAC	1 cut(s)	348
Bsp1286I	GDGCHC	1 cut(s)	139
Bsp143I	GATC	1 cut(s)	65
BspACI	CCGC	2 cut(s)	17, 216
BspFNI	CGCG	1 cut(s)	17
BspLI	GGNNCC	1 cut(s)	336
BspPI	GGATC	1 cut(s)	73
BsrDI	GCAATG	1 cut(s)	171
BssECI	CCNNGG	1 cut(s)	326
BssMI	GATC	1 cut(s)	65
Bst2UI	CCWGG	1 cut(s)	327
BstAPI	GCANNNNNTGC	1 cut(s)	161
BstC8I	GCNNGC	1 cut(s)	235
BstDEI	CTNAG	1 cut(s)	89
BstFNI	CGCG	1 cut(s)	17
BstKTI	GATC	1 cut(s)	68
BstMBI	GATC	1 cut(s)	65
BstMWI	GCNNNNNNNGC	4 cut(s)	44, 161, 182, 322
BstNI	CCWGG	1 cut(s)	327
BstSCI	CCNGG	1 cut(s)	325
BstUI	CGCG	1 cut(s)	17
BstV1I	GCAGC	6 cut(s)	22, 34, 85, 167, 194, 300
BstX2I	RGATCY	1 cut(s)	65
BstYI	RGATCY	1 cut(s)	65
BtrI	CACGTC	1 cut(s)	106
BtsI	GCAGTG	1 cut(s)	210
BtsIMutI	CAGTG	1 cut(s)	210
Cac8I	GCNNGC	1 cut(s)	235
CaiI	CAGNNNCTG	1 cut(s)	35
Cfr13I	GGNCC	2 cut(s)	196, 335
CseI	GACGC	1 cut(s)	23
CviAII	CATG	2 cut(s)	248, 409
CviJI	RGCY	6 cut(s)	47, 98, 137, 158, 313, 421
CviKI_1	RGCY	6 cut(s)	47, 98, 137, 158, 313, 421
DdeI	CTNAG	1 cut(s)	89
DpnI	GATC	1 cut(s)	67
DpnII	GATC	1 cut(s)	65
DraIII	CACNNNGTG	1 cut(s)	191
Eco24I	GRGCYC	1 cut(s)	139
Eco47I	GGWCC	2 cut(s)	196, 335
EcoRII	CCWGG	1 cut(s)	325
EcoT38I	GRGCYC	1 cut(s)	139
FaeI	CATG	2 cut(s)	251, 412
FaiI	YATR	9 cut(s)	75, 128, 130, 150, 221, 249, 410, 424, 426
FaqI	GGGAC	1 cut(s)	348
FatI	CATG	2 cut(s)	247, 408
FauI	CCCGC	1 cut(s)	10
FauNDI	CATATG	2 cut(s)	128, 424
Fnu4HI	GCNGC	7 cut(s)	36, 48, 99, 156, 183, 216, 314
FriOI	GRGCYC	1 cut(s)	139
Fsp4HI	GCNGC	7 cut(s)	36, 48, 99, 156, 183, 216, 314
GluI	GCNGC	7 cut(s)	36, 48, 99, 156, 183, 216, 314
HgaI	GACGC	1 cut(s)	23
Hin1II	CATG	2 cut(s)	251, 412
HinfI	GANTC	3 cut(s)	266, 287, 413
HphI	GGTGA	1 cut(s)	377
Hpy188I	TCNGA	4 cut(s)	70, 141, 265, 280
Hpy188III	TCNNGA	2 cut(s)	191, 270
HpyCH4IV	ACGT	1 cut(s)	105
HpyF10VI	GCNNNNNNNGC	4 cut(s)	44, 161, 182, 322
HpyF3I	CTNAG	1 cut(s)	89
HpySE526I	ACGT	1 cut(s)	105
Hsp92II	CATG	2 cut(s)	251, 412
Kzo9I	GATC	1 cut(s)	65
LpnPI	CCDG	8 cut(s)	10, 144, 219, 255, 312, 339, 351, 398
Lsp1109I	GCAGC	6 cut(s)	22, 34, 85, 167, 194, 300
LweI	GCATC	2 cut(s)	22, 409
MaeII	ACGT	1 cut(s)	105
MaeIII	GTNAC	1 cut(s)	6
MalI	GATC	1 cut(s)	67
MboI	GATC	1 cut(s)	65
MboII	GAAGA	1 cut(s)	359
MflI	RGATCY	1 cut(s)	65
MhlI	GDGCHC	1 cut(s)	139
MluCI	AATT	2 cut(s)	243, 392
MlyI	GAGTC	1 cut(s)	407
MmeI	TCCRAC	1 cut(s)	223
MnlI	CCTC	3 cut(s)	119, 126, 187
MspA1I	CMGCKG	1 cut(s)	158
MspR9I	CCNGG	1 cut(s)	327
MvaI	CCWGG	1 cut(s)	327
MvnI	CGCG	1 cut(s)	17
MwoI	GCNNNNNNNGC	4 cut(s)	44, 161, 182, 322
NdeI	CATATG	2 cut(s)	128, 424
NdeII	GATC	1 cut(s)	65
NlaIII	CATG	2 cut(s)	251, 412
NlaIV	GGNNCC	1 cut(s)	336
NmeAIII	GCCGAG	1 cut(s)	263
PfeI	GAWTC	2 cut(s)	266, 287
PkrI	GCNGC	7 cut(s)	37, 49, 100, 157, 184, 217, 315
PleI	GAGTC	1 cut(s)	407
PpsI	GAGTC	1 cut(s)	407
Psp6I	CCWGG	1 cut(s)	325
PspGI	CCWGG	1 cut(s)	325
PspN4I	GGNNCC	1 cut(s)	336
PspPI	GGNCC	2 cut(s)	196, 335
PstNI	CAGNNNCTG	1 cut(s)	35
PsuI	RGATCY	1 cut(s)	65
PvuII	CAGCTG	1 cut(s)	158
SatI	GCNGC	7 cut(s)	36, 48, 99, 156, 183, 216, 314
Sau3AI	GATC	1 cut(s)	65
Sau96I	GGNCC	2 cut(s)	196, 335
SchI	GAGTC	1 cut(s)	407
ScrFI	CCNGG	1 cut(s)	327
SduI	GDGCHC	1 cut(s)	139
SetI	ASST	6 cut(s)	49, 108, 160, 198, 208, 315
SfaNI	GCATC	2 cut(s)	22, 409
SinI	GGWCC	2 cut(s)	196, 335
Sse9I	AATT	2 cut(s)	243, 392
SsiI	CCGC	2 cut(s)	17, 216
SspI	AATATT	1 cut(s)	371
StyD4I	CCNGG	1 cut(s)	325
TaiI	ACGT	1 cut(s)	108
TasI	AATT	2 cut(s)	243, 392
TauI	GCSGC	1 cut(s)	218
TfiI	GAWTC	2 cut(s)	266, 287
TscAI	CASTG	1 cut(s)	217
TseI	GCWGC	6 cut(s)	35, 47, 98, 155, 182, 313
TspDTI	ATGAA	4 cut(s)	214, 236, 300, 360
TspGWI	ACGGA	1 cut(s)	101
TspRI	CASTG	1 cut(s)	217
VpaK11BI	GGWCC	2 cut(s)	196, 335
XapI	RAATTY	1 cut(s)	243

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.