Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0015692.1

Orthogroup ID

OG0018385

Physical Location & Seq

Genomic Coordinates Reverse (-)

17568 .. 18206

Gene Structure 639 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0015692.1_g000005.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 639 bp

atgggaaggagggaggtttcatggagtctcattttcttggcgatggggctggttagttttgtatctgttgaagccacggggaggtctctgagagacaaggggaatgacttgaacaaggggctccaggattggcacggtaaagagactacatatggcgaaatgacagctggtggtttcgggggagggtcttataatagagatgaactggacaaggggctccagagttggcgcggtaaagagactacctacgaagacctgacagctggtggttatgggggcgggtctggtttcggctctggtggtagtgggggttttggcagtgggggtggtataggaaatggtggtgatggtggcagtggctttggaggcggtgctggttatgggggtggatctggtaatggtggtggattgggtggtggttatggaaatggtggcggatttggcaatggcagtgggggtggtggattcggtaatggtggaggctttggcagtggaggtggtggaggaggtggtggctttggcaatggtagtggaggaagtggacaaggggggggctcgggcgtggggtcaggtccagggtatggtggtggtggtggtggtggaggtggaggatatgatcatgatgggaggaagaactag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

212

Amino Acids

19.44

Weight (kDa)

5.3

Isoelectric Point (pI)

35.52

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018385)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g33330
malus_domestica	MD08G1087800.v1.1
prunus_persica	Prupe.1G425300_v2.0.a1
pyrus_communis	pycom15g06790
rosa_chinensis	RchiOBHm_Chr6g0309291
rosa_laevigata	RLG00000010576
rosa_multiflora	Rmu_sc0015692.1_g000005
rosa_rugosa	Rorug06G0370700
rosa_samantha	Rh6AG484100
rosa_wichuraiana	Rw6G042140

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	192
AccB7I	CCANNNNNTGG	1 cut(s)	581
AccII	CGCG	1 cut(s)	231
AciI	CCGC	4 cut(s)	231, 279, 369, 435
AclWI	GGATC	1 cut(s)	397
AfiI	CCNNNNNNNGG	2 cut(s)	81, 581
AgsI	TTSAA	2 cut(s)	71, 112
AjnI	CCWGG	2 cut(s)	123, 574
AluBI	AGCT	2 cut(s)	167, 263
AluI	AGCT	2 cut(s)	167, 263
Alw26I	GTCTC	5 cut(s)	32, 87, 90, 137, 233
AlwI	GGATC	1 cut(s)	397
Ama87I	CYCGRG	1 cut(s)	556
AspLEI	GCGC	1 cut(s)	231
AspS9I	GGNCC	1 cut(s)	572
AsuHPI	GGTGA	1 cut(s)	356
AvaI	CYCGRG	1 cut(s)	556
AvaII	GGWCC	1 cut(s)	572
BanII	GRGCYC	3 cut(s)	123, 219, 557
BbsI	GAAGAC	1 cut(s)	258
BccI	CCATC	3 cut(s)	37, 341, 617
BciT130I	CCWGG	2 cut(s)	125, 576
BclI	TGATCA	1 cut(s)	616
BcoDI	GTCTC	5 cut(s)	32, 87, 90, 137, 233
BfaI	CTAG	1 cut(s)	637
Bme1390I	CCNGG	2 cut(s)	125, 576
Bme18I	GGWCC	1 cut(s)	572
BmeT110I	CYCGRG	1 cut(s)	556
BmgT120I	GGNCC	1 cut(s)	572
BmiI	GGNNCC	2 cut(s)	122, 218
BmrFI	CCNGG	2 cut(s)	125, 576
BpiI	GAAGAC	1 cut(s)	258
BpmI	CTGGAG	2 cut(s)	107, 203
BsaI	GGTCTC	1 cut(s)	90
BsaJI	CCNNGG	2 cut(s)	75, 575
Bsc4I	CCNNNNNNNGG	2 cut(s)	81, 581
Bse1I	ACTGG	1 cut(s)	210
Bse3DI	GCAATG	2 cut(s)	451, 529
BseBI	CCWGG	2 cut(s)	125, 576
BseDI	CCNNGG	2 cut(s)	75, 575
BseLI	CCNNNNNNNGG	2 cut(s)	81, 581
BseMI	GCAATG	2 cut(s)	451, 529
BseMII	CTCAG	1 cut(s)	80
BseNI	ACTGG	1 cut(s)	210
BseRI	GAGGAG	1 cut(s)	519
Bsh1236I	CGCG	1 cut(s)	231
BsiHKCI	CYCGRG	1 cut(s)	556
BslI	CCNNNNNNNGG	2 cut(s)	81, 581
BsmAI	GTCTC	5 cut(s)	32, 87, 90, 137, 233
Bso31I	GGTCTC	1 cut(s)	90
BsoBI	CYCGRG	1 cut(s)	556
Bsp1286I	GDGCHC	3 cut(s)	123, 219, 557
Bsp143I	GATC	2 cut(s)	389, 616
BspACI	CCGC	4 cut(s)	231, 279, 369, 435
BspCNI	CTCAG	1 cut(s)	81
BspFNI	CGCG	1 cut(s)	231
BspHI	TCATGA	1 cut(s)	619
BspLI	GGNNCC	2 cut(s)	122, 218
BspPI	GGATC	1 cut(s)	397
BspTNI	GGTCTC	1 cut(s)	90
BsrDI	GCAATG	2 cut(s)	451, 529
BsrI	ACTGG	1 cut(s)	210
BssECI	CCNNGG	2 cut(s)	75, 575
BssMI	GATC	2 cut(s)	389, 616
Bst2UI	CCWGG	2 cut(s)	125, 576
Bst4CI	ACNGT	1 cut(s)	137
BstDEI	CTNAG	1 cut(s)	89
BstDSI	CCRYGG	1 cut(s)	75
BstFNI	CGCG	1 cut(s)	231
BstHHI	GCGC	1 cut(s)	231
BstKTI	GATC	2 cut(s)	392, 619
BstMAI	GTCTC	5 cut(s)	32, 87, 90, 137, 233
BstMBI	GATC	2 cut(s)	389, 616
BstMWI	GCNNNNNNNGC	2 cut(s)	366, 441
BstNI	CCWGG	2 cut(s)	125, 576
BstSCI	CCNGG	2 cut(s)	123, 574
BstUI	CGCG	1 cut(s)	231
BstV2I	GAAGAC	1 cut(s)	258
BstX2I	RGATCY	1 cut(s)	389
BstYI	RGATCY	1 cut(s)	389
BtgI	CCRYGG	1 cut(s)	75
BtgZI	GCGATG	1 cut(s)	56
BtsI	GCAGTG	4 cut(s)	325, 361, 457, 496
BtsIMutI	CAGTG	4 cut(s)	325, 361, 457, 496
CciI	TCATGA	1 cut(s)	619
CfoI	GCGC	1 cut(s)	231
Cfr13I	GGNCC	1 cut(s)	572
CspCI	CAANNNNNGTGG	4 cut(s)	433, 468, 511, 546
CviAII	CATG	2 cut(s)	21, 620
DdeI	CTNAG	1 cut(s)	89
DpnI	GATC	2 cut(s)	391, 618
DpnII	GATC	2 cut(s)	389, 616
EciI	GGCGGA	1 cut(s)	450
Eco24I	GRGCYC	3 cut(s)	123, 219, 557
Eco31I	GGTCTC	1 cut(s)	90
Eco47I	GGWCC	1 cut(s)	572
Eco88I	CYCGRG	1 cut(s)	556
EcoRII	CCWGG	2 cut(s)	123, 574
EcoT38I	GRGCYC	3 cut(s)	123, 219, 557
FaeI	CATG	2 cut(s)	24, 623
FatI	CATG	2 cut(s)	20, 619
FauI	CCCGC	1 cut(s)	272
FauNDI	CATATG	1 cut(s)	151
FbaI	TGATCA	1 cut(s)	616
FriOI	GRGCYC	3 cut(s)	123, 219, 557
FspBI	CTAG	1 cut(s)	637
GlaI	GCGC	1 cut(s)	230
GsuI	CTGGAG	2 cut(s)	107, 203
HhaI	GCGC	1 cut(s)	231
Hin1II	CATG	2 cut(s)	24, 623
Hin6I	GCGC	1 cut(s)	229
HinP1I	GCGC	1 cut(s)	229
HinfI	GANTC	2 cut(s)	25, 465
HphI	GGTGA	1 cut(s)	356
Hpy166II	GTNNAC	1 cut(s)	542
Hpy188I	TCNGA	1 cut(s)	90
Hpy188III	TCNNGA	2 cut(s)	220, 620
Hpy8I	GTNNAC	1 cut(s)	542
HpyCH4III	ACNGT	1 cut(s)	137
HpyF10VI	GCNNNNNNNGC	2 cut(s)	366, 441
HpyF3I	CTNAG	1 cut(s)	89
Hsp92II	CATG	2 cut(s)	24, 623
HspAI	GCGC	1 cut(s)	229
Ksp22I	TGATCA	1 cut(s)	616
Kzo9I	GATC	2 cut(s)	389, 616
LmnI	GCTCC	2 cut(s)	126, 222
MaeI	CTAG	1 cut(s)	637
MalI	GATC	2 cut(s)	391, 618
MboI	GATC	2 cut(s)	389, 616
MboII	GAAGA	1 cut(s)	263
MflI	RGATCY	1 cut(s)	389
MhlI	GDGCHC	3 cut(s)	123, 219, 557
MlyI	GAGTC	1 cut(s)	34
MspA1I	CMGCKG	2 cut(s)	167, 263
MspR9I	CCNGG	2 cut(s)	125, 576
MvaI	CCWGG	2 cut(s)	125, 576
MvnI	CGCG	1 cut(s)	231
MwoI	GCNNNNNNNGC	2 cut(s)	366, 441
NdeI	CATATG	1 cut(s)	151
NdeII	GATC	2 cut(s)	389, 616
NlaIII	CATG	2 cut(s)	24, 623
NlaIV	GGNNCC	2 cut(s)	122, 218
PagI	TCATGA	1 cut(s)	619
PfeI	GAWTC	1 cut(s)	465
PflMI	CCANNNNNTGG	1 cut(s)	581
PfoI	TCCNGGA	1 cut(s)	123
PleI	GAGTC	1 cut(s)	33
PpsI	GAGTC	1 cut(s)	33
PsiI	TTATAA	1 cut(s)	192
Psp6I	CCWGG	2 cut(s)	123, 574
PspGI	CCWGG	2 cut(s)	123, 574
PspN4I	GGNNCC	2 cut(s)	122, 218
PspPI	GGNCC	1 cut(s)	572
PsuI	RGATCY	1 cut(s)	389
PvuII	CAGCTG	2 cut(s)	167, 263
Sau3AI	GATC	2 cut(s)	389, 616
Sau96I	GGNCC	1 cut(s)	572
SchI	GAGTC	1 cut(s)	34
ScrFI	CCNGG	2 cut(s)	125, 576
SduI	GDGCHC	3 cut(s)	123, 219, 557
SinI	GGWCC	1 cut(s)	572
SsiI	CCGC	4 cut(s)	231, 279, 369, 435
SspMI	CTAG	1 cut(s)	637
StyD4I	CCNGG	2 cut(s)	123, 574
TaaI	ACNGT	1 cut(s)	137
TfiI	GAWTC	1 cut(s)	465
TscAI	CASTG	4 cut(s)	325, 361, 457, 496
TspDTI	ATGAA	2 cut(s)	9, 216
TspRI	CASTG	4 cut(s)	325, 361, 457, 496
Van91I	CCANNNNNTGG	1 cut(s)	581
VpaK11BI	GGWCC	1 cut(s)	572
XspI	CTAG	1 cut(s)	637

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.