Rmu_sc0018042.1_g000001

Protein MODIFIER OF SNC1

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0018042.1
Physical Location & Seq
Forward (+)
1 .. 4246
4246 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0018042.1_g000001.1.cds

Sequence Viewer

Length: 3989 bp
gtgatatctctgtaaatgcaagtgtgaagagtggaactggtaattcatggaaaagagagaatccctcatacaatgaagatggaggtagacctggtatggagaagtggcagggaaatccccagccttaccctggtgctagtgtcccgccccaacattatgatgcatggcatggtggtcctgttcacccgcaaggtggtccagtacctcacccccaaggtggggtttggtttagaggtcctccagggggtcctccttttggagcccaggtccctcctggtggcttcccaatggaaccatttccatattatcctccacaaattccagctgctgctcttgccaacccacagcctgttcctccaactggagcaggaccaaggggacaccatcctaaaaatggagagatgtacagacctcatatgccagaggcatatatccgccccggtatgccaattagacctggattttaccctggtcctgtggcctttgagggatattatggttcaccaatgggatattgcaattcaaatgaacgagatgtcccatttgtgggaatgccagctggtcctcccgtctataacaggtaccctagccaaagtgctcctgagcctggcagacctagtggatatggtcccaccagccaaacagggttaccggagaaaatagcatctggtcatccacatgatacacgtggaccatacaaagttcttctgaagcagcatgatggttgggatagaagaaatgaagaacagagaagtgaggttgctgtaacaaccaatgcgtcatgtcttgagagtgaggaccaaccaagagcattgtcattggagaatgattggagatcagatcgcagaaaggagggagagagggatcgaaggagtgaaagacctgcttcgcagaattctgaccgaggagcttcttctgctcgtgtcaaagtcaaatcgcctgaaagtttgggtaatatgagggcagctgatgccatcccagtgaagaaattggaaactgaagcctgtggcacacaagatattgcacaaacactctctgcaaaagaccccagtctgattcagaaaatagagggattaaatgccaaagcacgagtttctgatggacgaggtgatactgcatctgtttccattagggaggagcaaaggaagacattccaagtcaaccctaaatctaacagttcagtaaatgaaccaggtagtggctcggccactgaaatcataaattcctctcatgaagtcagcagtggaatttctgtctccaggggacctgctcatggcatgcatggtaaatcagataatcgtggtagaggaaggtttaataaccaagaaggcgacggctgggggaagaaatccttggtctctgaaccaacatctgtggtgtcaactgcaaattcaaaagttccttctaatgttcatgtgcatgaccaccttgcttccatggaagctactgaaaagtctggatcttatccacaaggcagacgtgaagacgactcattgacaccaatgtttgatccaaatgattctgaggcacagcgtgctaagatgaaggagctagccaagcaacgtaccaaacagcttcaggaggaagaggaggagcggacaagaaggcagatggcgaaggctcgtgcaaaattagaagagttgaacagacgtactcaagtggtggacggttcaaatcaaaagtttgaaaattcctccagtggtgatgtccagagtaaacaagaagaatctcaaacttctggtgaaccattagtggccggtaggaaatatgatccacaagtcccagctttcggttctaacctcaatgctgttgaacagattaaagagtgcatcagtgttgaagttgcagaatcaactgttccatcaattgagctaccttcggagaggccaaagagtgcctacaaggaggagcccattttcatgcatgatcaacctgtgcctttgcagcagcaggttactattgctaatactgctcatcacaacactgcttcccaggctcatgatagcagtatctcaaggcagaagcaggcacctaaacaaaagcagaacactcggttggaaaagaagtctattgggaagaatacttccactagtatgactgacacaccaaatagtcagacagatacagtggttaatgtgtcctcatctggtggagttggagctacttcaactgcattgagtactgagtcaagcctgactgcaaattctagtgctatacttgagtcatcttctcatccaagaaagaaaaataacagaagtggcaagaacaagcagagagcagagaattcatcatctgtggctgctatatcatcatctatatcaaatgatacaaatcatgcaaacaccactatagaaactggaaaaccaaatgtacctaatgtggatttagatcctagctcagttcagtcacagaccttttctagggatgcatatcagtcgatggagcagcacttgtctctaccaaacgaagaatctcaaggtagattaagtggccagtggaaacctcagcattctcgccggatgcctaggaattcacaagcaatcaggcactcggaaaaatttcaaagcagcgatgctgttatgtgggcaccagtgcggtcacagaacaaaactgatgtaactgatgatgccatccccaaaaccgaagctgaggctgtcagtgctgtaaagagcgaccatcaagtgcaaaataattcaagaaataagagggcggaaatggagagatatgttccaaagcctgtagctaaagaaatggcacatcaaggaagcactcaacaagcaatggtttctgtagtgcatcagactgcaataaatgagaacatcaggggagcagattctggtcctcctcaaggtgtcgaaaattctcaacctagtgctgcagtgggaaaagcaggttttgccatagaatccaggaatgggagtagcaggcaaaataagcaggtaaaagcacatgggtcgtggcgacaacggggatcaacagaaccaaccaacacgcaaggtttccatgaggaaccatcatatacttcaaatgttggtcagagtgatattgtctcagtgacagagcaaccaaagaattctgatgattggaatgatggatggaacatgccggatgaacccaacactgttgtaccagtctctgcatctattgctgtaaaagaacagggaatacctggaagacgaaagcagcatccatttaagggacaaaaaactgtggcaaataatcatgatcatgagcaaaagaaaaactataggggggatgctgacagaatctacaccaaatcttcagcctctgaaatgagtcaaacagagttaccttctgcttctaaagagaatcaagctgttggggaacgtgcaattcctcattggcagcccaaatctcaggcatttgcagccaataatcatcgaggaaacagggctactggtccccaaggtgcagagccactctcaccaacaactgacaaagatgccactgaacatctggctcagcatcgacatgatcaatacaagtctgaaagaaacaatgcaggggaaggacagaacaggagggagaggaaaacaacacacaagggacgtcccggctccccaagtcatggtcctgtcagcccagtcgagctggctcctcctagtatggatgctagacaagagcatcagtttcaaacggggtttcgaaggaatggaaaccaaaacaaccgtttcagcagagggcaagagtctcgtggggattggaattactcggggcatgatggtaggcagcaaaacccccctgcaaatcgggacaggcagaggcacagttcccatttggagtaccagccagttgggccatacaacagcagtgacaaatttaacaattccgagggacctagagaaggtgctcagaattcaggtggtggaagggtcaaggaaagagtccagggtcattcgaaacgtagtggagggaacttccatgggcggcaaagtggcactattcgagtagtgccggatatggagtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

1328

Amino Acids

145.11

Weight (kDa)

9.08

Isoelectric Point (pI)

57.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 3573
Acc36I ACCTGC 5 cut(s) 891, 1275, 1941, 2881, 2928
Acc65I GGTACC 1 cut(s) 581
AccB1I GGYRCC 3 cut(s) 581, 2028, 2586
AccB7I CCANNNNNTGG 2 cut(s) 1198, 3589
AccBSI CCGCTC 1 cut(s) 1596
AccI GTMKAC 1 cut(s) 87
AciI CCGC 7 cut(s) 145, 187, 435, 1596, 2595, 2710, 3948
AclWI GGATC 6 cut(s) 872, 1467, 1504, 1765, 2383, 2979
AcoI YGGCCR 3 cut(s) 1205, 1754, 2490
AcuI CTGAAG 4 cut(s) 730, 1019, 1561, 3266
AcvI CACGTG 1 cut(s) 688
AcyI GRCGYC 1 cut(s) 3570
AdeI CACNNNGTG 1 cut(s) 1534
AfaI GTAC 9 cut(s) 203, 406, 583, 1566, 1653, 2181, 2372, 3128, 3805
AflIII ACRYGT 1 cut(s) 685
AhlI ACTAGT 1 cut(s) 2089
AjiI CACGTC 1 cut(s) 1480
AjuI GAANNNNNNNTTGG 4 cut(s) 1336, 1368, 2038, 2070
AloI GAACNNNNNNTCC 2 cut(s) 521, 553
Alw21I GWGCWC 2 cut(s) 600, 3873
Alw26I GTCTC 6 cut(s) 1260, 1362, 2459, 3054, 3138, 3716
AlwI GGATC 6 cut(s) 872, 1467, 1504, 1765, 2383, 2979
AlwNI CAGNNNCTG 4 cut(s) 328, 2836, 3136, 3289
Ama87I CYCGRG 1 cut(s) 3732
AoxI GGCC 6 cut(s) 479, 1205, 1754, 1885, 2490, 3817
Asp700I GAANNNNTTC 3 cut(s) 296, 1150, 2558
Asp718I GGTACC 1 cut(s) 581
AspA2I CCTAGG 1 cut(s) 2524
AsuC2I CCSGG 2 cut(s) 440, 3575
AsuHPI GGTGA 7 cut(s) 175, 199, 494, 1120, 1714, 1753, 3437
AsuII TTCGAA 2 cut(s) 3666, 3919
AsuNHI GCTAGC 1 cut(s) 1551
AvaI CYCGRG 1 cut(s) 3732
AvrII CCTAGG 1 cut(s) 2524
BaeGI GKGCMC 1 cut(s) 2589
BaeI ACNNNNGTAYC 4 cut(s) 2114, 2147, 3110, 3143
BalI TGGCCA 1 cut(s) 2492
BanI GGYRCC 3 cut(s) 581, 2028, 2586
BanII GRGCYC 2 cut(s) 264, 1913
BauI CACGAG 4 cut(s) 920, 1088, 1622, 3713
BbrPI CACGTG 1 cut(s) 688
BbsI GAAGAC 3 cut(s) 1153, 1490, 3180
Bbv12I GWGCWC 2 cut(s) 600, 3873
BbvCI CCTCAGC 2 cut(s) 2504, 2648
BceAI ACGGC 1 cut(s) 1350
BcgI CGANNNNNNTGC 8 cut(s) 2032, 2066, 2417, 2451, 2936, 2970, 3694, 3728
BclI TGATCA 3 cut(s) 1926, 3225, 3495
BcnI CCSGG 2 cut(s) 440, 3575
BcoDI GTCTC 6 cut(s) 1260, 1362, 2459, 3054, 3138, 3716
BcuI ACTAGT 1 cut(s) 2089
BfmI CTRYAG 5 cut(s) 2348, 2738, 2789, 2876, 3246
BfuAI ACCTGC 5 cut(s) 891, 1275, 1941, 2881, 2928
BglI GCCNNNNNGGC 1 cut(s) 3816
BlnI CCTAGG 1 cut(s) 2524
BlpI GCTNAGC 1 cut(s) 3482
BmcAI AGTACT 1 cut(s) 2181
BmeT110I CYCGRG 1 cut(s) 3732
BmgBI CACGTC 1 cut(s) 1480
BmrI ACTGGG 3 cut(s) 973, 1043, 3598
BmtI GCTAGC 1 cut(s) 1555
BmuI ACTGGG 3 cut(s) 973, 1043, 3598
BoxI GACNNNNGTC 1 cut(s) 1049
BpiI GAAGAC 3 cut(s) 1153, 1490, 3180
BplI GAGNNNNNCTC 4 cut(s) 49, 81, 3427, 3459
BpmI CTGGAG 4 cut(s) 224, 383, 1242, 1680
Bpu10I CCTNAGC 3 cut(s) 602, 2504, 2648
Bpu1102I GCTNAGC 1 cut(s) 3482
Bpu14I TTCGAA 2 cut(s) 3666, 3919
BpuEI CTTGAG 6 cut(s) 808, 1640, 1998, 2239, 2459, 2831
BpuMI CCSGG 2 cut(s) 440, 3575
BsaAI YACGTR 1 cut(s) 688
BsaBI GATNNNNATC 3 cut(s) 2330, 2387, 2429
BsaHI GRCGYC 1 cut(s) 3570
BsaI GGTCTC 1 cut(s) 1362
BsaWI WCCGGW 1 cut(s) 651
BsaXI ACNNNNNCTCC 2 cut(s) 251, 281
Bse118I RCCGGY 1 cut(s) 1756
Bse3DI GCAATG 1 cut(s) 2786
Bse8I GATNNNNATC 3 cut(s) 2330, 2387, 2429
BseJI GATNNNNATC 3 cut(s) 2330, 2387, 2429
BseMI GCAATG 1 cut(s) 2786
BseRI GAGGAG 7 cut(s) 920, 1150, 1603, 1606, 1921, 2834, 3608
BseSI GKGCMC 1 cut(s) 2589
BseYI CCCAGC 3 cut(s) 119, 1337, 1782
BsgI GTGCAG 1 cut(s) 3452
BshFI GGCC 6 cut(s) 481, 1207, 1756, 1887, 2492, 3819
BshNI GGYRCC 3 cut(s) 581, 2028, 2586
BsiHKAI GWGCWC 2 cut(s) 600, 3873
BsiHKCI CYCGRG 1 cut(s) 3732
BsiSI CCGG 7 cut(s) 440, 652, 1757, 2517, 3106, 3575, 3976
BsmAI GTCTC 6 cut(s) 1260, 1362, 2459, 3054, 3138, 3716
BsmI GAATGC 2 cut(s) 557, 2508
BsnI GGCC 6 cut(s) 481, 1207, 1756, 1887, 2492, 3819
Bso31I GGTCTC 1 cut(s) 1362
BsoBI CYCGRG 1 cut(s) 3732
Bsp119I TTCGAA 2 cut(s) 3666, 3919
Bsp1286I GDGCHC 5 cut(s) 264, 600, 1913, 2589, 3873
Bsp1407I TGTACA 1 cut(s) 404
Bsp1720I GCTNAGC 1 cut(s) 3482
Bsp19I CCATGG 2 cut(s) 1436, 3942
BspACI CCGC 7 cut(s) 145, 187, 435, 1596, 2595, 2710, 3948
BspANI GGCC 6 cut(s) 481, 1207, 1756, 1887, 2492, 3819
BspHI TCATGA 4 cut(s) 1230, 1998, 3222, 3228
BspMAI CTGCAG 1 cut(s) 2880
BspMI ACCTGC 5 cut(s) 891, 1275, 1941, 2881, 2928
BspOI GCTAGC 1 cut(s) 1555
BspPI GGATC 6 cut(s) 872, 1467, 1504, 1765, 2383, 2979
BspT104I TTCGAA 2 cut(s) 3666, 3919
BspT107I GGYRCC 3 cut(s) 581, 2028, 2586
BspTNI GGTCTC 1 cut(s) 1362
BsrBI CCGCTC 1 cut(s) 1596
BsrDI GCAATG 1 cut(s) 2786
BsrFI RCCGGY 1 cut(s) 1756
BsrGI TGTACA 1 cut(s) 404
BssAI RCCGGY 1 cut(s) 1756
BssNI GRCGYC 1 cut(s) 3570
BssSI CACGAG 4 cut(s) 920, 1088, 1622, 3713
BssT1I CCWWGG 7 cut(s) 213, 373, 1352, 1436, 2524, 3426, 3942
Bst2BI CACGAG 4 cut(s) 920, 1088, 1622, 3713
Bst4CI ACNGT 8 cut(s) 1177, 1669, 1857, 2127, 3123, 3210, 3691, 3790
Bst6I CTCTTC 3 cut(s) 22, 1580, 1631
BstACI GRCGYC 1 cut(s) 3570
BstAPI GCANNNNNTGC 4 cut(s) 970, 1534, 2896, 3145
BstAUI TGTACA 1 cut(s) 404
BstBAI YACGTR 1 cut(s) 688
BstBI TTCGAA 2 cut(s) 3666, 3919
BstC8I GCNNGC 7 cut(s) 557, 1279, 1535, 1553, 2027, 2926, 3614
BstDSI CCRYGG 2 cut(s) 1436, 3942
BstEII GGTNACC 1 cut(s) 647
BstENI CCTNNNNNAGG 3 cut(s) 2418, 2846, 3863
BstMAI GTCTC 6 cut(s) 1260, 1362, 2459, 3054, 3138, 3716
BstNSI RCATGY 2 cut(s) 1281, 3105
BstPAI GACNNNNGTC 1 cut(s) 1049
BstPI GGTNACC 1 cut(s) 647
BstSFI CTRYAG 5 cut(s) 2348, 2738, 2789, 2876, 3246
BstSLI GKGCMC 1 cut(s) 2589
BstV2I GAAGAC 3 cut(s) 1153, 1490, 3180
BstX2I RGATCY 2 cut(s) 1459, 2388
BstXI CCANNNNNNTGG 1 cut(s) 3814
BstYI RGATCY 2 cut(s) 1459, 2388
BsuRI GGCC 6 cut(s) 481, 1207, 1756, 1887, 2492, 3819
BtgI CCRYGG 2 cut(s) 1436, 3942
BtgZI GCGATG 1 cut(s) 2585
BtrI CACGTC 1 cut(s) 1480
BtsI GCAGTG 4 cut(s) 1248, 1982, 2885, 3837
BveI ACCTGC 5 cut(s) 891, 1275, 1941, 2881, 2928
Cac8I GCNNGC 7 cut(s) 557, 1279, 1535, 1553, 2027, 2926, 3614
CaiI CAGNNNCTG 4 cut(s) 328, 2836, 3136, 3289
CciI TCATGA 4 cut(s) 1230, 1998, 3222, 3228
Cfr10I RCCGGY 1 cut(s) 1756
CseI GACGC 1 cut(s) 767
CsiI ACCWGGT 2 cut(s) 90, 1191
Csp6I GTAC 9 cut(s) 202, 405, 582, 1565, 1652, 2180, 2371, 3127, 3804
CspCI CAANNNNNGTGG 2 cut(s) 1355, 1390
CviQI GTAC 9 cut(s) 202, 405, 582, 1565, 1652, 2180, 2371, 3127, 3804
DraIII CACNNNGTG 1 cut(s) 1534
EaeI YGGCCR 3 cut(s) 1205, 1754, 2490
Eam1104I CTCTTC 3 cut(s) 22, 1580, 1631
EarI CTCTTC 3 cut(s) 22, 1580, 1631
EciI GGCGGA 2 cut(s) 424, 2725
Eco130I CCWWGG 7 cut(s) 213, 373, 1352, 1436, 2524, 3426, 3942
Eco24I GRGCYC 2 cut(s) 264, 1913
Eco31I GGTCTC 1 cut(s) 1362
Eco32I GATATC 1 cut(s) 6
Eco57I CTGAAG 4 cut(s) 730, 1019, 1561, 3266
Eco72I CACGTG 1 cut(s) 688
Eco88I CYCGRG 1 cut(s) 3732
Eco91I GGTNACC 1 cut(s) 647
EcoNI CCTNNNNNAGG 3 cut(s) 2418, 2846, 3863
EcoO109I RGGNCCY 5 cut(s) 235, 247, 267, 1264, 3856
EcoO65I GGTNACC 1 cut(s) 647
EcoRI GAATTC 5 cut(s) 894, 2283, 2529, 3072, 3876
EcoRV GATATC 1 cut(s) 6
EcoT14I CCWWGG 7 cut(s) 213, 373, 1352, 1436, 2524, 3426, 3942
EcoT22I ATGCAT 4 cut(s) 165, 1283, 1925, 2430
EcoT38I GRGCYC 2 cut(s) 264, 1913
ErhI CCWWGG 7 cut(s) 213, 373, 1352, 1436, 2524, 3426, 3942
FalI AAGNNNNNCTT 4 cut(s) 870, 902, 1336, 1368
FauI CCCGC 2 cut(s) 152, 194
FauNDI CATATG 1 cut(s) 416
FbaI TGATCA 3 cut(s) 1926, 3225, 3495
FblI GTMKAC 1 cut(s) 87
FriOI GRGCYC 2 cut(s) 264, 1913
GsaI CCCAGC 3 cut(s) 123, 1341, 1786
GsuI CTGGAG 4 cut(s) 224, 383, 1242, 1680
HaeIII GGCC 6 cut(s) 481, 1207, 1756, 1887, 2492, 3819
HapII CCGG 7 cut(s) 440, 652, 1757, 2517, 3106, 3575, 3976
HgaI GACGC 1 cut(s) 767
Hin1I GRCGYC 1 cut(s) 3570
HincII GTYRAC 2 cut(s) 1161, 1382
HindII GTYRAC 2 cut(s) 1161, 1382
HpaII CCGG 7 cut(s) 440, 652, 1757, 2517, 3106, 3575, 3976
HphI GGTGA 7 cut(s) 175, 199, 494, 1120, 1714, 1753, 3437
Hpy166II GTNNAC 9 cut(s) 88, 183, 502, 691, 1161, 1382, 1665, 1717, 1744
Hpy8I GTNNAC 9 cut(s) 88, 183, 502, 691, 1161, 1382, 1665, 1717, 1744
Hpy99I CGWCG 1 cut(s) 1336
HpyCH4III ACNGT 8 cut(s) 1177, 1669, 1857, 2127, 3123, 3210, 3691, 3790
HpyCH4IV ACGT 7 cut(s) 687, 1479, 1563, 1650, 3348, 3570, 3924
HpySE526I ACGT 7 cut(s) 687, 1479, 1563, 1650, 3348, 3570, 3924
Hsp92I GRCGYC 1 cut(s) 3570
KpnI GGTACC 1 cut(s) 585
Ksp22I TGATCA 3 cut(s) 1926, 3225, 3495
MabI ACCWGGT 2 cut(s) 90, 1191
MaeII ACGT 7 cut(s) 687, 1479, 1563, 1650, 3348, 3570, 3924
MaeIII GTNAC 9 cut(s) 647, 765, 1953, 2405, 2597, 2616, 3054, 3308, 3832
MbiI CCGCTC 1 cut(s) 1596
MfeI CAATTG 1 cut(s) 1865
MflI RGATCY 2 cut(s) 1459, 2388
MhlI GDGCHC 5 cut(s) 264, 600, 1913, 2589, 3873
MlsI TGGCCA 1 cut(s) 2492
MluNI TGGCCA 1 cut(s) 2492
MlyI GAGTC 6 cut(s) 1483, 2194, 2230, 3306, 3718, 3914
MmeI TCCRAC 3 cut(s) 382, 2036, 2136
Mox20I TGGCCA 1 cut(s) 2492
Mph1103I ATGCAT 4 cut(s) 165, 1283, 1925, 2430
MroXI GAANNNNTTC 3 cut(s) 296, 1150, 2558
MscI TGGCCA 1 cut(s) 2492
MseI TTAA 7 cut(s) 1075, 1316, 1820, 2132, 2485, 3194, 3842
MslI CAYNNNNRTG 8 cut(s) 158, 677, 979, 1418, 1918, 2092, 3227, 3491
Msp20I TGGCCA 1 cut(s) 2492
MspA1I CMGCKG 3 cut(s) 325, 559, 967
MspI CCGG 7 cut(s) 440, 652, 1757, 2517, 3106, 3575, 3976
MunI CAATTG 1 cut(s) 1865
Mva1269I GAATGC 2 cut(s) 557, 2508
NciI CCSGG 2 cut(s) 440, 3575
NcoI CCATGG 2 cut(s) 1436, 3942
NdeI CATATG 1 cut(s) 416
NheI GCTAGC 1 cut(s) 1551
NmeAIII GCCGAG 1 cut(s) 1183
NmuCI GTSAC 4 cut(s) 2405, 2597, 3054, 3832
NsiI ATGCAT 4 cut(s) 165, 1283, 1925, 2430
NspI RCATGY 2 cut(s) 1281, 3105
NspV TTCGAA 2 cut(s) 3666, 3919
PaeI GCATGC 1 cut(s) 1281
PagI TCATGA 4 cut(s) 1230, 1998, 3222, 3228
PctI GAATGC 2 cut(s) 557, 2508
PdmI GAANNNNTTC 3 cut(s) 296, 1150, 2558
PflMI CCANNNNNTGG 2 cut(s) 1198, 3589
PfoI TCCNGGA 1 cut(s) 2908
PleI GAGTC 6 cut(s) 1483, 2193, 2229, 3305, 3717, 3913
PmaCI CACGTG 1 cut(s) 688
PmlI CACGTG 1 cut(s) 688
PpsI GAGTC 6 cut(s) 1483, 2193, 2229, 3305, 3717, 3913
Ppu21I YACGTR 1 cut(s) 688
PpuMI RGGWCCY 5 cut(s) 235, 247, 267, 1264, 3856
PshAI GACNNNNGTC 1 cut(s) 1049
Psp5II RGGWCCY 5 cut(s) 235, 247, 267, 1264, 3856
PspCI CACGTG 1 cut(s) 688
PspEI GGTNACC 1 cut(s) 647
PspFI CCCAGC 3 cut(s) 119, 1337, 1782
PspPPI RGGWCCY 5 cut(s) 235, 247, 267, 1264, 3856
PsrI GAACNNNNNNTAC 2 cut(s) 3149, 3181
PstI CTGCAG 1 cut(s) 2880
PstNI CAGNNNCTG 4 cut(s) 328, 2836, 3136, 3289
PsuI RGATCY 2 cut(s) 1459, 2388
PvuII CAGCTG 3 cut(s) 325, 559, 967
RsaI GTAC 9 cut(s) 203, 406, 583, 1566, 1653, 2181, 2372, 3128, 3805
RsaNI GTAC 9 cut(s) 202, 405, 582, 1565, 1652, 2180, 2371, 3127, 3804
RseI CAYNNNNRTG 8 cut(s) 158, 677, 979, 1418, 1918, 2092, 3227, 3491
SaqAI TTAA 7 cut(s) 1075, 1316, 1820, 2132, 2485, 3194, 3842
ScaI AGTACT 1 cut(s) 2181
SchI GAGTC 6 cut(s) 1483, 2194, 2230, 3306, 3718, 3914
SduI GDGCHC 5 cut(s) 264, 600, 1913, 2589, 3873
SexAI ACCWGGT 2 cut(s) 90, 1191
SfcI CTRYAG 5 cut(s) 2348, 2738, 2789, 2876, 3246
SfuI TTCGAA 2 cut(s) 3666, 3919
SmiMI CAYNNNNRTG 8 cut(s) 158, 677, 979, 1418, 1918, 2092, 3227, 3491
SmlI CTYRAG 6 cut(s) 787, 1655, 2013, 2218, 2474, 2846
SmoI CTYRAG 6 cut(s) 787, 1655, 2013, 2218, 2474, 2846
SpeI ACTAGT 1 cut(s) 2089
SphI GCATGC 1 cut(s) 1281
SsiI CCGC 7 cut(s) 145, 187, 435, 1596, 2595, 2710, 3948
StyI CCWWGG 7 cut(s) 213, 373, 1352, 1436, 2524, 3426, 3942
TaaI ACNGT 8 cut(s) 1177, 1669, 1857, 2127, 3123, 3210, 3691, 3790
TaiI ACGT 7 cut(s) 690, 1482, 1566, 1653, 3351, 3573, 3927
TaqI TCGA 9 cut(s) 867, 2437, 2855, 3402, 3489, 3608, 3666, 3919, 3966
TaqII GACCGA 1 cut(s) 917
TatI WGTACW 2 cut(s) 404, 2179
TauI GCSGC 1 cut(s) 3951
Tru1I TTAA 7 cut(s) 1075, 1316, 1820, 2132, 2485, 3194, 3842
Tru9I TTAA 7 cut(s) 1075, 1316, 1820, 2132, 2485, 3194, 3842
TseFI GTSAC 4 cut(s) 2405, 2597, 3054, 3832
Tsp45I GTSAC 4 cut(s) 2405, 2597, 3054, 3832
Van91I CCANNNNNTGG 2 cut(s) 1198, 3589
XagI CCTNNNNNAGG 3 cut(s) 2418, 2846, 3863
XceI RCATGY 2 cut(s) 1281, 3105
XcmI CCANNNNNNNNNTGG 4 cut(s) 127, 271, 391, 3474
XmaJI CCTAGG 1 cut(s) 2524
XmiI GTMKAC 1 cut(s) 87
XmnI GAANNNNTTC 3 cut(s) 296, 1150, 2558
ZraI GACGTC 1 cut(s) 3571
ZrmI AGTACT 1 cut(s) 2181
Zsp2I ATGCAT 4 cut(s) 165, 1283, 1925, 2430
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.