Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0019492.1

Orthogroup ID

OG0009939

Physical Location & Seq

Genomic Coordinates Forward (+)

560 .. 1428

Gene Structure 869 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0019492.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 351 bp

atgcttggactagatgcggcgggtaaaacaaccatcctttacaaactgcatattggagaagtcttgtcaactgttcctacaataggttttaatgtggaaaaagttcagtacaagaatgtgatgttcacagtttgggatgttggtgggcaagagaaactaaggccgctctggaggcattactttaataatacggatggactgatttatgtcgttgactctttggacagggagagaattggacgagccaaggcagaatttcaggccataatcagtgatccatttatgctcaacagtgtcatcttggtgtttgcgaacaaacaggatatggtaagtaatagcactagtttctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Arf

Protein Analysis

116

Amino Acids

13.14

Weight (kDa)

6.72

Isoelectric Point (pI)

33.64

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009939)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G17060 AT5G17060
fragaria_vesca	FvH4_7g33830
malus_domestica	MD01G1234300.v1.1 MD07G1306800.v1.1
prunus_persica	Prupe.2G324600_v2.0.a1 Prupe.2G324600_v2.0.a1 Prupe.2G324600_v2.0.a1 Prupe.2G324600_v2.0.a1
pyrus_communis	pycom07g27980
rosa_chinensis	RchiOBHm_Chr1g0383941
rosa_multiflora	Rmu_sc0019492.1_g000001 Rmu_sc0033299.1_g000001
rosa_roxburghii	Rroxscaffold_4G00277120
rosa_rugosa	Rorug01G0443600.1 Rorug01G0443700
rosa_samantha	Rh1AG469200 Rh1BG426900 Rh1CG439700 Rh1DG459700
rosa_wichuraiana	Rw1G040320

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	166
AciI	CCGC	3 cut(s)	17, 20, 164
AclWI	GGATC	1 cut(s)	269
AcsI	RAATTY	1 cut(s)	254
AfaI	GTAC	1 cut(s)	110
AfiI	CCNNNNNNNGG	1 cut(s)	83
AhlI	ACTAGT	1 cut(s)	341
AlwI	GGATC	1 cut(s)	269
AoxI	GGCC	2 cut(s)	161, 261
ApoI	RAATTY	1 cut(s)	254
Asp700I	GAANNNNTTC	1 cut(s)	102
BccI	CCATC	2 cut(s)	41, 188
BcuI	ACTAGT	1 cut(s)	341
BfaI	CTAG	2 cut(s)	11, 342
BisI	GCNGC	2 cut(s)	18, 164
BlsI	GCNGC	2 cut(s)	19, 165
BmsI	GCATC	1 cut(s)	4
BpmI	CTGGAG	1 cut(s)	190
BsaJI	CCNNGG	1 cut(s)	246
Bsc4I	CCNNNNNNNGG	1 cut(s)	83
BseDI	CCNNGG	1 cut(s)	246
BseGI	GGATG	3 cut(s)	33, 142, 199
BseLI	CCNNNNNNNGG	1 cut(s)	83
BshFI	GGCC	2 cut(s)	163, 263
BslI	CCNNNNNNNGG	1 cut(s)	83
BsnI	GGCC	2 cut(s)	163, 263
Bsp143I	GATC	1 cut(s)	274
BspACI	CCGC	3 cut(s)	17, 20, 164
BspANI	GGCC	2 cut(s)	163, 263
BspPI	GGATC	1 cut(s)	269
BsrBI	CCGCTC	1 cut(s)	166
BssECI	CCNNGG	1 cut(s)	246
BssMI	GATC	1 cut(s)	274
BssT1I	CCWWGG	1 cut(s)	246
Bst4CI	ACNGT	3 cut(s)	73, 130, 293
BstDEI	CTNAG	1 cut(s)	158
BstENI	CCTNNNNNAGG	1 cut(s)	81
BstF5I	GGATG	3 cut(s)	33, 142, 199
BstKTI	GATC	1 cut(s)	277
BstMBI	GATC	1 cut(s)	274
BstMWI	GCNNNNNNNGC	1 cut(s)	172
BsuRI	GGCC	2 cut(s)	163, 263
BtsCI	GGATG	3 cut(s)	33, 142, 199
BtsIMutI	CAGTG	2 cut(s)	277, 298
Csp6I	GTAC	1 cut(s)	109
CviJI	RGCY	3 cut(s)	163, 245, 263
CviKI_1	RGCY	3 cut(s)	163, 245, 263
CviQI	GTAC	1 cut(s)	109
DdeI	CTNAG	1 cut(s)	158
DpnI	GATC	1 cut(s)	276
DpnII	GATC	1 cut(s)	274
Eco130I	CCWWGG	1 cut(s)	246
EcoNI	CCTNNNNNAGG	1 cut(s)	81
EcoT14I	CCWWGG	1 cut(s)	246
ErhI	CCWWGG	1 cut(s)	246
FaiI	YATR	5 cut(s)	51, 207, 266, 284, 326
FauI	CCCGC	1 cut(s)	13
Fnu4HI	GCNGC	2 cut(s)	18, 164
FokI	GGATG	3 cut(s)	20, 149, 206
Fsp4HI	GCNGC	2 cut(s)	18, 164
FspBI	CTAG	2 cut(s)	11, 342
GluI	GCNGC	2 cut(s)	18, 164
GsuI	CTGGAG	1 cut(s)	190
HaeIII	GGCC	2 cut(s)	163, 263
HincII	GTYRAC	2 cut(s)	69, 214
HindII	GTYRAC	2 cut(s)	69, 214
HinfI	GANTC	1 cut(s)	215
Hpy166II	GTNNAC	3 cut(s)	69, 126, 214
Hpy188I	TCNGA	1 cut(s)	350
Hpy188III	TCNNGA	1 cut(s)	169
Hpy8I	GTNNAC	3 cut(s)	69, 126, 214
HpyCH4III	ACNGT	3 cut(s)	73, 130, 293
HpyCH4V	TGCA	1 cut(s)	49
HpyF10VI	GCNNNNNNNGC	1 cut(s)	172
HpyF3I	CTNAG	1 cut(s)	158
Kzo9I	GATC	1 cut(s)	274
LpnPI	CCDG	4 cut(s)	154, 211, 245, 305
LweI	GCATC	1 cut(s)	4
MaeI	CTAG	2 cut(s)	11, 342
MalI	GATC	1 cut(s)	276
MbiI	CCGCTC	1 cut(s)	166
MboI	GATC	1 cut(s)	274
MluCI	AATT	2 cut(s)	234, 254
MlyI	GAGTC	1 cut(s)	209
MnlI	CCTC	1 cut(s)	165
MroXI	GAANNNNTTC	1 cut(s)	102
MseI	TTAA	2 cut(s)	90, 183
MslI	CAYNNNNRTG	1 cut(s)	302
MwoI	GCNNNNNNNGC	1 cut(s)	172
NdeII	GATC	1 cut(s)	274
PdmI	GAANNNNTTC	1 cut(s)	102
PkrI	GCNGC	2 cut(s)	19, 165
PleI	GAGTC	1 cut(s)	209
PpsI	GAGTC	1 cut(s)	209
RsaI	GTAC	1 cut(s)	110
RsaNI	GTAC	1 cut(s)	109
RseI	CAYNNNNRTG	1 cut(s)	302
SaqAI	TTAA	2 cut(s)	90, 183
SatI	GCNGC	2 cut(s)	18, 164
Sau3AI	GATC	1 cut(s)	274
SchI	GAGTC	1 cut(s)	209
SetI	ASST	1 cut(s)	88
SfaNI	GCATC	1 cut(s)	4
SmiMI	CAYNNNNRTG	1 cut(s)	302
SpeI	ACTAGT	1 cut(s)	341
Sse9I	AATT	2 cut(s)	234, 254
SsiI	CCGC	3 cut(s)	17, 20, 164
SspMI	CTAG	2 cut(s)	11, 342
StyI	CCWWGG	1 cut(s)	246
TaaI	ACNGT	3 cut(s)	73, 130, 293
TasI	AATT	2 cut(s)	234, 254
TatI	WGTACW	1 cut(s)	108
TauI	GCSGC	2 cut(s)	20, 166
Tru1I	TTAA	2 cut(s)	90, 183
Tru9I	TTAA	2 cut(s)	90, 183
TscAI	CASTG	2 cut(s)	277, 298
TspGWI	ACGGA	1 cut(s)	206
TspRI	CASTG	2 cut(s)	277, 298
XagI	CCTNNNNNAGG	1 cut(s)	81
XapI	RAATTY	1 cut(s)	254
XmnI	GAANNNNTTC	1 cut(s)	102
XspI	CTAG	2 cut(s)	11, 342

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.