Rmu_sc0033299.1_g000001
ERF Family

Belongs to the small GTPase superfamily. Arf family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0033299.1
Physical Location & Seq
Reverse (-)
2 .. 1413
1412 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0033299.1_g000001.1.cds

Sequence Viewer

Length: 413 bp
atgcttggactagatgcggcgggtaaaacaaccatcctttacaaactgcatattggagaagtcttgtcaactgttcctacaataggttttaatgtggaaaaagttcagtacaagaatgtgatgttcacagtttgggatgttggtgggcaagagaaactaaggccgctctggaggcattactttaataatacggatggactgatttatgtcgttgactctttggacagggagagaattggacgagccaaggcagaatttcaggccataatcagtgatccatttatgctcaacagtgtcatcttggtgtttgcgaacaaacaggatatgaaaggggctatgtccccaatggaagtatgtgaagggttaggcctgtttgatctcaagaacagaaaatggcacatacaggggacctg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

137

Amino Acids

15.55

Weight (kDa)

7.85

Isoelectric Point (pI)

39.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 166
AciI CCGC 3 cut(s) 17, 20, 164
AclWI GGATC 1 cut(s) 269
AcsI RAATTY 1 cut(s) 254
AfaI GTAC 1 cut(s) 110
AfiI CCNNNNNNNGG 1 cut(s) 83
AlwI GGATC 1 cut(s) 269
AoxI GGCC 3 cut(s) 161, 261, 367
ApoI RAATTY 1 cut(s) 254
Asp700I GAANNNNTTC 1 cut(s) 102
AspS9I GGNCC 1 cut(s) 408
AvaII GGWCC 1 cut(s) 408
BccI CCATC 2 cut(s) 41, 188
BfaI CTAG 1 cut(s) 11
BisI GCNGC 2 cut(s) 18, 164
BlsI GCNGC 2 cut(s) 19, 165
Bme18I GGWCC 1 cut(s) 408
BmgT120I GGNCC 1 cut(s) 408
BmiI GGNNCC 1 cut(s) 409
BmsI GCATC 1 cut(s) 4
BpmI CTGGAG 1 cut(s) 190
BpuEI CTTGAG 1 cut(s) 365
BsaJI CCNNGG 1 cut(s) 246
Bsc4I CCNNNNNNNGG 1 cut(s) 83
BseDI CCNNGG 1 cut(s) 246
BseGI GGATG 3 cut(s) 33, 142, 199
BseLI CCNNNNNNNGG 1 cut(s) 83
BshFI GGCC 3 cut(s) 163, 263, 369
BslFI GGGAC 1 cut(s) 325
BslI CCNNNNNNNGG 1 cut(s) 83
BsmFI GGGAC 1 cut(s) 325
BsnI GGCC 3 cut(s) 163, 263, 369
Bsp143I GATC 2 cut(s) 274, 376
BspACI CCGC 3 cut(s) 17, 20, 164
BspANI GGCC 3 cut(s) 163, 263, 369
BspLI GGNNCC 1 cut(s) 409
BspPI GGATC 1 cut(s) 269
BsrBI CCGCTC 1 cut(s) 166
BssECI CCNNGG 1 cut(s) 246
BssMI GATC 2 cut(s) 274, 376
BssT1I CCWWGG 1 cut(s) 246
Bst4CI ACNGT 3 cut(s) 73, 130, 293
BstDEI CTNAG 1 cut(s) 158
BstENI CCTNNNNNAGG 1 cut(s) 81
BstF5I GGATG 3 cut(s) 33, 142, 199
BstKTI GATC 2 cut(s) 277, 379
BstMBI GATC 2 cut(s) 274, 376
BstMWI GCNNNNNNNGC 1 cut(s) 172
BsuRI GGCC 3 cut(s) 163, 263, 369
BtsCI GGATG 3 cut(s) 33, 142, 199
BtsIMutI CAGTG 2 cut(s) 277, 298
Cfr13I GGNCC 1 cut(s) 408
Csp6I GTAC 1 cut(s) 109
CviJI RGCY 5 cut(s) 163, 245, 263, 335, 369
CviKI_1 RGCY 5 cut(s) 163, 245, 263, 335, 369
CviQI GTAC 1 cut(s) 109
DdeI CTNAG 1 cut(s) 158
DpnI GATC 2 cut(s) 276, 378
DpnII GATC 2 cut(s) 274, 376
Eco130I CCWWGG 1 cut(s) 246
Eco147I AGGCCT 1 cut(s) 369
Eco47I GGWCC 1 cut(s) 408
EcoNI CCTNNNNNAGG 1 cut(s) 81
EcoO109I RGGNCCY 1 cut(s) 408
EcoT14I CCWWGG 1 cut(s) 246
ErhI CCWWGG 1 cut(s) 246
FaiI YATR 8 cut(s) 51, 207, 266, 284, 326, 338, 355, 401
FaqI GGGAC 1 cut(s) 325
FauI CCCGC 1 cut(s) 13
Fnu4HI GCNGC 2 cut(s) 18, 164
FokI GGATG 3 cut(s) 20, 149, 206
Fsp4HI GCNGC 2 cut(s) 18, 164
FspBI CTAG 1 cut(s) 11
GluI GCNGC 2 cut(s) 18, 164
GsuI CTGGAG 1 cut(s) 190
HaeIII GGCC 3 cut(s) 163, 263, 369
HincII GTYRAC 2 cut(s) 69, 214
HindII GTYRAC 2 cut(s) 69, 214
HinfI GANTC 1 cut(s) 215
Hpy166II GTNNAC 3 cut(s) 69, 126, 214
Hpy188III TCNNGA 2 cut(s) 169, 382
Hpy8I GTNNAC 3 cut(s) 69, 126, 214
HpyAV CCTTC 1 cut(s) 353
HpyCH4III ACNGT 3 cut(s) 73, 130, 293
HpyCH4V TGCA 1 cut(s) 49
HpyF10VI GCNNNNNNNGC 1 cut(s) 172
HpyF3I CTNAG 1 cut(s) 158
Kzo9I GATC 2 cut(s) 274, 376
LpnPI CCDG 6 cut(s) 154, 211, 245, 305, 383, 389
LweI GCATC 1 cut(s) 4
MaeI CTAG 1 cut(s) 11
MalI GATC 2 cut(s) 276, 378
MbiI CCGCTC 1 cut(s) 166
MboI GATC 2 cut(s) 274, 376
MluCI AATT 2 cut(s) 234, 254
MlyI GAGTC 1 cut(s) 209
MnlI CCTC 1 cut(s) 165
MroXI GAANNNNTTC 1 cut(s) 102
MseI TTAA 2 cut(s) 90, 183
MslI CAYNNNNRTG 1 cut(s) 302
MwoI GCNNNNNNNGC 1 cut(s) 172
NdeII GATC 2 cut(s) 274, 376
NlaIV GGNNCC 1 cut(s) 409
PceI AGGCCT 1 cut(s) 369
PdmI GAANNNNTTC 1 cut(s) 102
PkrI GCNGC 2 cut(s) 19, 165
PleI GAGTC 1 cut(s) 209
PpsI GAGTC 1 cut(s) 209
PpuMI RGGWCCY 1 cut(s) 408
Psp5II RGGWCCY 1 cut(s) 408
PspN4I GGNNCC 1 cut(s) 409
PspPI GGNCC 1 cut(s) 408
PspPPI RGGWCCY 1 cut(s) 408
RsaI GTAC 1 cut(s) 110
RsaNI GTAC 1 cut(s) 109
RseI CAYNNNNRTG 1 cut(s) 302
SaqAI TTAA 2 cut(s) 90, 183
SatI GCNGC 2 cut(s) 18, 164
Sau3AI GATC 2 cut(s) 274, 376
Sau96I GGNCC 1 cut(s) 408
SchI GAGTC 1 cut(s) 209
SetI ASST 2 cut(s) 88, 413
SfaNI GCATC 1 cut(s) 4
SinI GGWCC 1 cut(s) 408
SmiMI CAYNNNNRTG 1 cut(s) 302
SmlI CTYRAG 1 cut(s) 380
SmoI CTYRAG 1 cut(s) 380
Sse9I AATT 2 cut(s) 234, 254
SseBI AGGCCT 1 cut(s) 369
SsiI CCGC 3 cut(s) 17, 20, 164
SspMI CTAG 1 cut(s) 11
StuI AGGCCT 1 cut(s) 369
StyI CCWWGG 1 cut(s) 246
TaaI ACNGT 3 cut(s) 73, 130, 293
TasI AATT 2 cut(s) 234, 254
TatI WGTACW 1 cut(s) 108
TauI GCSGC 2 cut(s) 20, 166
Tru1I TTAA 2 cut(s) 90, 183
Tru9I TTAA 2 cut(s) 90, 183
TscAI CASTG 2 cut(s) 277, 298
TspDTI ATGAA 1 cut(s) 341
TspGWI ACGGA 1 cut(s) 206
TspRI CASTG 2 cut(s) 277, 298
VpaK11BI GGWCC 1 cut(s) 408
XagI CCTNNNNNAGG 1 cut(s) 81
XapI RAATTY 1 cut(s) 254
XmnI GAANNNNTTC 1 cut(s) 102
XspI CTAG 1 cut(s) 11
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.