Rmu_sc0020722.1_g000003

protein retention in ER lumen

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0020722.1
Physical Location & Seq
Forward (+)
8520 .. 9495
976 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0020722.1_g000003.1.cds

Sequence Viewer

Length: 411 bp
atgccaaacgtgttggctttgattcagtggaagggaaactcagactacttcctcaaggtctctctctccaattcttattgcttggcacccctcctttgcttaaactacttcttcatctttctgaatctgtacgccaacaatctccagggtagtgaaatggcgacggaagcaccggggtgggcggatcaatggggcgccggaggcatcggtgcattggaagatgaagacaagaacaaaagcctggaagacaacaagaagaagaagggagagacaaagtctggactaaacaaagctaaggttgcagcaatggctggcgctgaaaagatcaaaagtggcacaaccaatggcatcaaatggatcaaaaatcagtgccagaagaagaaatctaccaagaccccaactgaagtttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

136

Amino Acids

14.91

Weight (kDa)

9.2

Isoelectric Point (pI)

22.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015968)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G62045
fragaria_vesca FvH4_3g01970
malus_domestica MD05G1347800.v1.1 MD10G1322200.v1.1
prunus_persica Prupe.4G019700_v2.0.a1
pyrus_communis pycom10g27270
rosa_chinensis RchiOBHm_Chr5g0002881
rosa_multiflora Rmu_sc0013603.1_g000008 Rmu_sc0020722.1_g000003
rosa_roxburghii Rroxscaffold_1G00072980
rosa_rugosa Rorug04G0400300
rosa_samantha Rh5AG023300 Rh5CG025900 Rh5DG024400
rosa_wichuraiana Rw5G002170

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 85, 194
AciI CCGC 1 cut(s) 182
AclWI GGATC 2 cut(s) 192, 365
AcyI GRCGYC 1 cut(s) 195
AfaI GTAC 1 cut(s) 131
AflIII ACRYGT 1 cut(s) 9
AjnI CCWGG 2 cut(s) 144, 240
AleI CACNNNNGTG 1 cut(s) 175
AluBI AGCT 1 cut(s) 293
AluI AGCT 1 cut(s) 293
Alw26I GTCTC 2 cut(s) 64, 263
AlwI GGATC 2 cut(s) 192, 365
ApeKI GCWGC 1 cut(s) 302
AspLEI GCGC 2 cut(s) 197, 317
AsuC2I CCSGG 1 cut(s) 174
BanI GGYRCC 2 cut(s) 85, 194
BbsI GAAGAC 2 cut(s) 231, 252
BbvI GCAGC 1 cut(s) 314
BciT130I CCWGG 2 cut(s) 146, 242
BcnI CCSGG 1 cut(s) 174
BcoDI GTCTC 2 cut(s) 64, 263
BfoI RGCGCY 2 cut(s) 198, 318
BisI GCNGC 1 cut(s) 303
BlsI GCNGC 1 cut(s) 304
Bme1390I CCNGG 3 cut(s) 146, 174, 242
BmiI GGNNCC 2 cut(s) 87, 196
BmrFI CCNGG 3 cut(s) 146, 174, 242
BmsI GCATC 2 cut(s) 213, 357
BpiI GAAGAC 2 cut(s) 231, 252
BpmI CTGGAG 1 cut(s) 128
Bpu10I CCTNAGC 1 cut(s) 294
BpuEI CTTGAG 1 cut(s) 38
BpuMI CCSGG 1 cut(s) 174
BsaHI GRCGYC 1 cut(s) 195
BsaI GGTCTC 1 cut(s) 64
BsaJI CCNNGG 2 cut(s) 145, 173
Bse3DI GCAATG 1 cut(s) 312
BseBI CCWGG 2 cut(s) 146, 242
BseDI CCNNGG 2 cut(s) 145, 173
BseMI GCAATG 1 cut(s) 312
BseMII CTCAG 1 cut(s) 54
BseXI GCAGC 1 cut(s) 314
BshNI GGYRCC 2 cut(s) 85, 194
BsiSI CCGG 2 cut(s) 173, 198
BsmAI GTCTC 2 cut(s) 64, 263
Bso31I GGTCTC 1 cut(s) 64
Bsp143I GATC 3 cut(s) 184, 324, 357
BspACI CCGC 1 cut(s) 182
BspCNI CTCAG 1 cut(s) 53
BspLI GGNNCC 2 cut(s) 87, 196
BspPI GGATC 2 cut(s) 192, 365
BspT107I GGYRCC 2 cut(s) 85, 194
BspTNI GGTCTC 1 cut(s) 64
BsrDI GCAATG 1 cut(s) 312
BssECI CCNNGG 2 cut(s) 145, 173
BssMI GATC 3 cut(s) 184, 324, 357
BssNI GRCGYC 1 cut(s) 195
Bst2UI CCWGG 2 cut(s) 146, 242
BstACI GRCGYC 1 cut(s) 195
BstC8I GCNNGC 1 cut(s) 313
BstDEI CTNAG 2 cut(s) 40, 294
BstH2I RGCGCY 2 cut(s) 198, 318
BstHHI GCGC 2 cut(s) 197, 317
BstKTI GATC 3 cut(s) 187, 327, 360
BstMAI GTCTC 2 cut(s) 64, 263
BstMBI GATC 3 cut(s) 184, 324, 357
BstMWI GCNNNNNNNGC 4 cut(s) 167, 201, 299, 308
BstNI CCWGG 2 cut(s) 146, 242
BstSCI CCNGG 3 cut(s) 144, 172, 240
BstV1I GCAGC 1 cut(s) 314
BstV2I GAAGAC 2 cut(s) 231, 252
BtsIMutI CAGTG 2 cut(s) 32, 374
Cac8I GCNNGC 1 cut(s) 313
CfoI GCGC 2 cut(s) 197, 317
Csp6I GTAC 1 cut(s) 130
CviJI RGCY 4 cut(s) 17, 240, 293, 311
CviKI_1 RGCY 4 cut(s) 17, 240, 293, 311
CviQI GTAC 1 cut(s) 130
DdeI CTNAG 2 cut(s) 40, 294
DinI GGCGCC 1 cut(s) 196
DpnI GATC 3 cut(s) 186, 326, 359
DpnII GATC 3 cut(s) 184, 324, 357
EciI GGCGGA 1 cut(s) 197
Eco31I GGTCTC 1 cut(s) 64
EcoRII CCWGG 2 cut(s) 144, 240
EgeI GGCGCC 1 cut(s) 196
EheI GGCGCC 1 cut(s) 196
Fnu4HI GCNGC 1 cut(s) 303
Fsp4HI GCNGC 1 cut(s) 303
GlaI GCGC 2 cut(s) 196, 316
GluI GCNGC 1 cut(s) 303
GsuI CTGGAG 1 cut(s) 128
HaeII RGCGCY 2 cut(s) 198, 318
HapII CCGG 2 cut(s) 173, 198
HhaI GCGC 2 cut(s) 197, 317
Hin1I GRCGYC 1 cut(s) 195
Hin6I GCGC 2 cut(s) 195, 315
HinP1I GCGC 2 cut(s) 195, 315
HinfI GANTC 2 cut(s) 22, 124
HpaII CCGG 2 cut(s) 173, 198
Hpy188I TCNGA 2 cut(s) 43, 123
Hpy188III TCNNGA 1 cut(s) 279
Hpy99I CGWCG 1 cut(s) 166
HpyAV CCTTC 2 cut(s) 25, 256
HpyCH4IV ACGT 1 cut(s) 9
HpyCH4V TGCA 2 cut(s) 212, 302
HpyF10VI GCNNNNNNNGC 4 cut(s) 167, 201, 299, 308
HpyF3I CTNAG 2 cut(s) 40, 294
HpySE526I ACGT 1 cut(s) 9
Hsp92I GRCGYC 1 cut(s) 195
HspAI GCGC 2 cut(s) 195, 315
KasI GGCGCC 1 cut(s) 194
Kzo9I GATC 3 cut(s) 184, 324, 357
LpnPI CCDG 9 cut(s) 131, 158, 186, 211, 227, 254, 264, 297, 386
Lsp1109I GCAGC 1 cut(s) 314
LweI GCATC 2 cut(s) 213, 357
MaeII ACGT 1 cut(s) 9
MalI GATC 3 cut(s) 186, 326, 359
MboI GATC 3 cut(s) 184, 324, 357
MboII GAAGA 8 cut(s) 103, 230, 236, 257, 268, 271, 388, 391
MluCI AATT 1 cut(s) 70
Mly113I GGCGCC 1 cut(s) 195
MnlI CCTC 3 cut(s) 62, 101, 194
MseI TTAA 2 cut(s) 101, 409
MslI CAYNNNNRTG 1 cut(s) 175
MspI CCGG 2 cut(s) 173, 198
MspR9I CCNGG 3 cut(s) 146, 174, 242
MvaI CCWGG 2 cut(s) 146, 242
MwoI GCNNNNNNNGC 4 cut(s) 167, 201, 299, 308
NarI GGCGCC 1 cut(s) 195
NciI CCSGG 1 cut(s) 174
NdeII GATC 3 cut(s) 184, 324, 357
NlaIV GGNNCC 2 cut(s) 87, 196
OliI CACNNNNGTG 1 cut(s) 175
PfeI GAWTC 2 cut(s) 22, 124
PflFI GACNNNGTC 1 cut(s) 274
PkrI GCNGC 1 cut(s) 304
PluTI GGCGCC 1 cut(s) 198
Psp6I CCWGG 2 cut(s) 144, 240
PspGI CCWGG 2 cut(s) 144, 240
PspN4I GGNNCC 2 cut(s) 87, 196
PsyI GACNNNGTC 1 cut(s) 274
RsaI GTAC 1 cut(s) 131
RsaNI GTAC 1 cut(s) 130
RseI CAYNNNNRTG 1 cut(s) 175
SaqAI TTAA 2 cut(s) 101, 409
SatI GCNGC 1 cut(s) 303
Sau3AI GATC 3 cut(s) 184, 324, 357
ScrFI CCNGG 3 cut(s) 146, 174, 242
SetI ASST 4 cut(s) 12, 60, 295, 300
SfaNI GCATC 2 cut(s) 213, 357
SfoI GGCGCC 1 cut(s) 196
SmiMI CAYNNNNRTG 1 cut(s) 175
SmlI CTYRAG 1 cut(s) 53
SmoI CTYRAG 1 cut(s) 53
Sse9I AATT 1 cut(s) 70
SsiI CCGC 1 cut(s) 182
SspDI GGCGCC 1 cut(s) 194
StyD4I CCNGG 3 cut(s) 144, 172, 240
TaiI ACGT 1 cut(s) 12
TasI AATT 1 cut(s) 70
TfiI GAWTC 2 cut(s) 22, 124
Tru1I TTAA 2 cut(s) 101, 409
Tru9I TTAA 2 cut(s) 101, 409
TscAI CASTG 2 cut(s) 32, 374
TseI GCWGC 1 cut(s) 302
TspDTI ATGAA 2 cut(s) 103, 237
TspGWI ACGGA 1 cut(s) 179
TspRI CASTG 2 cut(s) 32, 374
Tth111I GACNNNGTC 1 cut(s) 274
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.