Rmu_sc0022860.1_g000001

COBRA-like protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0022860.1
Physical Location & Seq
Forward (+)
1 .. 469
469 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0022860.1_g000001.1.cds

Sequence Viewer

Length: 375 bp
tggactctggtcattcagcaccctaatctcaacaatgtcacacaagttttcagctttgactacaagcctcttgttccttatgagtccataaatgacactggtatgttctatggattgaaatacttcaatgaccaattaatggaagccgggccatttgggaacgttcagtcggaaattcttcttaagaaggacataaacacatttactttcaaggaggggtgggcatttcctcgaaaagtttacttcaatggtgatgagtgccagatgcccccacctgatacatacccatttctgcctaattctgcccatcaaaagctactttcattctcagcattggtttccacattaattttcttgttgatagctatttggtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

124

Amino Acids

14.33

Weight (kDa)

5.16

Isoelectric Point (pI)

26.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019274)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 139
AclI AACGTT 1 cut(s) 162
AcsI RAATTY 1 cut(s) 174
AfiI CCNNNNNNNGG 1 cut(s) 139
AflII CTTAAG 1 cut(s) 182
AgsI TTSAA 4 cut(s) 118, 127, 211, 247
AluBI AGCT 3 cut(s) 54, 316, 365
AluI AGCT 3 cut(s) 54, 316, 365
AoxI GGCC 1 cut(s) 149
ApoI RAATTY 1 cut(s) 174
AseI ATTAAT 2 cut(s) 137, 347
Asp700I GAANNNNTTC 2 cut(s) 122, 177
AspS9I GGNCC 1 cut(s) 149
AsuC2I CCSGG 1 cut(s) 148
AsuHPI GGTGA 1 cut(s) 263
BccI CCATC 1 cut(s) 315
BcnI CCSGG 1 cut(s) 148
BfrI CTTAAG 1 cut(s) 182
Bme1390I CCNGG 1 cut(s) 148
BmgT120I GGNCC 1 cut(s) 149
BmrFI CCNGG 1 cut(s) 148
BmsI GCATC 1 cut(s) 255
BoxI GACNNNNGTC 1 cut(s) 8
BpuMI CCSGG 1 cut(s) 148
Bsc4I CCNNNNNNNGG 1 cut(s) 139
Bse1I ACTGG 1 cut(s) 103
BseLI CCNNNNNNNGG 1 cut(s) 139
BseMII CTCAG 1 cut(s) 342
BseNI ACTGG 1 cut(s) 103
BshFI GGCC 1 cut(s) 151
BsiSI CCGG 1 cut(s) 147
BslI CCNNNNNNNGG 1 cut(s) 139
BsnI GGCC 1 cut(s) 151
BspANI GGCC 1 cut(s) 151
BspCNI CTCAG 1 cut(s) 341
BspTI CTTAAG 1 cut(s) 182
BsrI ACTGG 1 cut(s) 103
BstAFI CTTAAG 1 cut(s) 182
BstDEI CTNAG 1 cut(s) 328
BstPAI GACNNNNGTC 1 cut(s) 8
BstSCI CCNGG 1 cut(s) 146
BsuRI GGCC 1 cut(s) 151
BtsIMutI CAGTG 1 cut(s) 96
Cfr13I GGNCC 1 cut(s) 149
CviJI RGCY 6 cut(s) 54, 67, 146, 151, 316, 365
CviKI_1 RGCY 6 cut(s) 54, 67, 146, 151, 316, 365
DdeI CTNAG 1 cut(s) 328
FaiI YATR 6 cut(s) 81, 89, 104, 111, 194, 283
HaeIII GGCC 1 cut(s) 151
HapII CCGG 1 cut(s) 147
HinfI GANTC 2 cut(s) 4, 83
HpaII CCGG 1 cut(s) 147
HphI GGTGA 1 cut(s) 263
Hpy166II GTNNAC 1 cut(s) 241
Hpy188I TCNGA 1 cut(s) 172
Hpy8I GTNNAC 1 cut(s) 241
HpyAV CCTTC 1 cut(s) 181
HpyCH4IV ACGT 1 cut(s) 162
HpyF3I CTNAG 1 cut(s) 328
HpySE526I ACGT 1 cut(s) 162
LpnPI CCDG 4 cut(s) 84, 160, 275, 288
LweI GCATC 1 cut(s) 255
MaeII ACGT 1 cut(s) 162
MaeIII GTNAC 1 cut(s) 37
MboII GAAGA 1 cut(s) 170
MluCI AATT 4 cut(s) 134, 174, 298, 348
MlyI GAGTC 1 cut(s) 92
MmeI TCCRAC 1 cut(s) 150
MnlI CCTC 3 cut(s) 78, 208, 240
MroXI GAANNNNTTC 2 cut(s) 122, 177
MseI TTAA 3 cut(s) 137, 183, 347
MslI CAYNNNNRTG 1 cut(s) 101
MspCI CTTAAG 1 cut(s) 182
MspI CCGG 1 cut(s) 147
MspR9I CCNGG 1 cut(s) 148
NciI CCSGG 1 cut(s) 148
NmuCI GTSAC 1 cut(s) 37
PdmI GAANNNNTTC 2 cut(s) 122, 177
PflMI CCANNNNNTGG 1 cut(s) 139
PleI GAGTC 1 cut(s) 91
PpsI GAGTC 1 cut(s) 91
PshAI GACNNNNGTC 1 cut(s) 8
PshBI ATTAAT 2 cut(s) 137, 347
Psp1406I AACGTT 1 cut(s) 162
PspPI GGNCC 1 cut(s) 149
RseI CAYNNNNRTG 1 cut(s) 101
SaqAI TTAA 3 cut(s) 137, 183, 347
Sau96I GGNCC 1 cut(s) 149
SchI GAGTC 1 cut(s) 92
ScrFI CCNGG 1 cut(s) 148
SetI ASST 5 cut(s) 56, 165, 277, 318, 367
SfaNI GCATC 1 cut(s) 255
SmiMI CAYNNNNRTG 1 cut(s) 101
SmlI CTYRAG 1 cut(s) 182
SmoI CTYRAG 1 cut(s) 182
Sse9I AATT 4 cut(s) 134, 174, 298, 348
StyD4I CCNGG 1 cut(s) 146
TaiI ACGT 1 cut(s) 165
TaqI TCGA 1 cut(s) 232
TasI AATT 4 cut(s) 134, 174, 298, 348
Tru1I TTAA 3 cut(s) 137, 183, 347
Tru9I TTAA 3 cut(s) 137, 183, 347
TscAI CASTG 1 cut(s) 103
TseFI GTSAC 1 cut(s) 37
Tsp45I GTSAC 1 cut(s) 37
TspDTI ATGAA 1 cut(s) 312
TspRI CASTG 1 cut(s) 103
Van91I CCANNNNNTGG 1 cut(s) 139
Vha464I CTTAAG 1 cut(s) 182
VspI ATTAAT 2 cut(s) 137, 347
XapI RAATTY 1 cut(s) 174
XmnI GAANNNNTTC 2 cut(s) 122, 177
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.