Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0027409.1

Orthogroup ID

OG0012991

Physical Location & Seq

Genomic Coordinates Forward (+)

61 .. 1809

Gene Structure 1749 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0027409.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 477 bp

atggcaaataccatcgctggcgaggaaacagttcataaacttgcctcacttttgctcgtatttcttggcggtggttacattgtgttgtttttaactggaaaaggtggtcacagtcattcacataaccaacccatggaaaaaatggctgttgctgggctcgtccttgttcctgccttgtctccttgtgcaaccacacttccggtatttcttgctgtcggcaattcatcttctatgatggtgcttgctatcatagtgctgctattcagcaccataacagtgatgacttcattggttgctctctcattctatggtgccagccagctcaaatttcactgggtggagcgatatgacaaacttctagtaggatctgtgctctgtttggtgggaattttgacacttatttttcatgatcatgatcatgatggagcaggaggatccactggagagcatttgcataggaaaatcattgttcactga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

158

Amino Acids

16.84

Weight (kDa)

6.82

Isoelectric Point (pI)

24.03

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012991)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G21070
fragaria_vesca	FvH4_3g27140 FvH4_3g27140
malus_domestica	MD11G1180800.v1.1
prunus_persica	Prupe.6G153600_v2.0.a1
pyrus_communis	pycom11g15600
rosa_chinensis	RchiOBHm_Chr5g0049761 RchiOBHm_Chr5g0049771
rosa_laevigata	RLG00000034645
rosa_multiflora	Rmu_sc0008923.1_g000002 Rmu_sc0015943.1_g000004 Rmu_sc0027409.1_g000001
rosa_roxburghii	Rroxscaffold_1G00031700
rosa_rugosa	Rorug05G0251000
rosa_samantha	Rh5AG327000 Rh5BG338100 Rh5DG350300
rosa_wichuraiana	Rw5G030890

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	311
AccB7I	CCANNNNNTGG	1 cut(s)	133
AciI	CCGC	1 cut(s)	69
AclWI	GGATC	3 cut(s)	373, 429, 442
AcsI	RAATTY	2 cut(s)	326, 387
AdeI	CACNNNGTG	1 cut(s)	337
AfiI	CCNNNNNNNGG	1 cut(s)	133
AluBI	AGCT	1 cut(s)	322
AluI	AGCT	1 cut(s)	322
Alw21I	GWGCWC	1 cut(s)	375
Alw26I	GTCTC	1 cut(s)	183
AlwI	GGATC	3 cut(s)	373, 429, 442
ApeKI	GCWGC	1 cut(s)	256
ApoI	RAATTY	2 cut(s)	326, 387
Asp700I	GAANNNNTTC	1 cut(s)	30
BamHI	GGATCC	1 cut(s)	434
BanI	GGYRCC	1 cut(s)	311
BanII	GRGCYC	1 cut(s)	159
Bbv12I	GWGCWC	1 cut(s)	375
BbvI	GCAGC	1 cut(s)	243
BccI	CCATC	3 cut(s)	20, 229, 416
BclI	TGATCA	2 cut(s)	409, 415
BcoDI	GTCTC	1 cut(s)	183
BfaI	CTAG	1 cut(s)	359
BisI	GCNGC	1 cut(s)	257
BlsI	GCNGC	1 cut(s)	258
BmiI	GGNNCC	2 cut(s)	313, 436
BmrI	ACTGGG	1 cut(s)	343
BmuI	ACTGGG	1 cut(s)	343
BpmI	CTGGAG	1 cut(s)	462
BsaBI	GATNNNNATC	1 cut(s)	414
BsaJI	CCNNGG	1 cut(s)	132
BsaWI	WCCGGW	1 cut(s)	199
Bsc4I	CCNNNNNNNGG	1 cut(s)	133
Bse1I	ACTGG	3 cut(s)	100, 338, 445
Bse8I	GATNNNNATC	1 cut(s)	414
BseDI	CCNNGG	1 cut(s)	132
BseJI	GATNNNNATC	1 cut(s)	414
BseLI	CCNNNNNNNGG	1 cut(s)	133
BseNI	ACTGG	3 cut(s)	100, 338, 445
BseXI	GCAGC	1 cut(s)	243
BseYI	CCCAGC	1 cut(s)	152
BshNI	GGYRCC	1 cut(s)	311
BsiHKAI	GWGCWC	1 cut(s)	375
BsiSI	CCGG	1 cut(s)	200
BslI	CCNNNNNNNGG	1 cut(s)	133
BsmAI	GTCTC	1 cut(s)	183
Bsp1286I	GDGCHC	2 cut(s)	159, 375
Bsp143I	GATC	4 cut(s)	365, 409, 415, 434
Bsp19I	CCATGG	1 cut(s)	132
BspACI	CCGC	1 cut(s)	69
BspHI	TCATGA	3 cut(s)	406, 412, 418
BspLI	GGNNCC	2 cut(s)	313, 436
BspPI	GGATC	3 cut(s)	373, 429, 442
BspT107I	GGYRCC	1 cut(s)	311
BsrI	ACTGG	3 cut(s)	100, 338, 445
BssECI	CCNNGG	1 cut(s)	132
BssMI	GATC	4 cut(s)	365, 409, 415, 434
BssT1I	CCWWGG	1 cut(s)	132
Bst4CI	ACNGT	3 cut(s)	31, 113, 277
BstC8I	GCNNGC	4 cut(s)	19, 243, 316, 320
BstDSI	CCRYGG	1 cut(s)	132
BstKTI	GATC	4 cut(s)	368, 412, 418, 437
BstMAI	GTCTC	1 cut(s)	183
BstMBI	GATC	4 cut(s)	365, 409, 415, 434
BstV1I	GCAGC	1 cut(s)	243
BstX2I	RGATCY	2 cut(s)	365, 434
BstYI	RGATCY	2 cut(s)	365, 434
BtgI	CCRYGG	1 cut(s)	132
BtsIMutI	CAGTG	4 cut(s)	282, 331, 438, 472
Cac8I	GCNNGC	4 cut(s)	19, 243, 316, 320
CciI	TCATGA	3 cut(s)	406, 412, 418
CviAII	CATG	4 cut(s)	133, 407, 413, 419
CviJI	RGCY	4 cut(s)	146, 157, 318, 322
CviKI_1	RGCY	4 cut(s)	146, 157, 318, 322
DpnI	GATC	4 cut(s)	367, 411, 417, 436
DpnII	GATC	4 cut(s)	365, 409, 415, 434
DraIII	CACNNNGTG	1 cut(s)	337
Eco130I	CCWWGG	1 cut(s)	132
Eco24I	GRGCYC	1 cut(s)	159
EcoT14I	CCWWGG	1 cut(s)	132
EcoT38I	GRGCYC	1 cut(s)	159
ErhI	CCWWGG	1 cut(s)	132
FaeI	CATG	4 cut(s)	136, 410, 416, 422
FatI	CATG	4 cut(s)	132, 406, 412, 418
FbaI	TGATCA	2 cut(s)	409, 415
Fnu4HI	GCNGC	1 cut(s)	257
FriOI	GRGCYC	1 cut(s)	159
Fsp4HI	GCNGC	1 cut(s)	257
FspBI	CTAG	1 cut(s)	359
GluI	GCNGC	1 cut(s)	257
GsaI	CCCAGC	1 cut(s)	156
GsuI	CTGGAG	1 cut(s)	462
HapII	CCGG	1 cut(s)	200
Hin1II	CATG	4 cut(s)	136, 410, 416, 422
HpaII	CCGG	1 cut(s)	200
Hpy166II	GTNNAC	1 cut(s)	472
Hpy188III	TCNNGA	3 cut(s)	407, 413, 419
Hpy8I	GTNNAC	1 cut(s)	472
HpyCH4III	ACNGT	3 cut(s)	31, 113, 277
HpyCH4V	TGCA	2 cut(s)	188, 454
Hsp92II	CATG	4 cut(s)	136, 410, 416, 422
Ksp22I	TGATCA	2 cut(s)	409, 415
Kzo9I	GATC	4 cut(s)	365, 409, 415, 434
LmnI	GCTCC	2 cut(s)	340, 425
Lsp1109I	GCAGC	1 cut(s)	243
MaeI	CTAG	1 cut(s)	359
MaeIII	GTNAC	2 cut(s)	74, 107
MalI	GATC	4 cut(s)	367, 411, 417, 436
MboI	GATC	4 cut(s)	365, 409, 415, 434
MboII	GAAGA	1 cut(s)	219
MflI	RGATCY	2 cut(s)	365, 434
MhlI	GDGCHC	2 cut(s)	159, 375
MluCI	AATT	3 cut(s)	220, 326, 387
MnlI	CCTC	3 cut(s)	16, 55, 425
MroXI	GAANNNNTTC	1 cut(s)	30
MseI	TTAA	1 cut(s)	92
MslI	CAYNNNNRTG	3 cut(s)	275, 411, 417
MspI	CCGG	1 cut(s)	200
NcoI	CCATGG	1 cut(s)	132
NdeII	GATC	4 cut(s)	365, 409, 415, 434
NlaIII	CATG	4 cut(s)	136, 410, 416, 422
NlaIV	GGNNCC	2 cut(s)	313, 436
NmuCI	GTSAC	1 cut(s)	107
PagI	TCATGA	3 cut(s)	406, 412, 418
PdmI	GAANNNNTTC	1 cut(s)	30
PflMI	CCANNNNNTGG	1 cut(s)	133
PkrI	GCNGC	1 cut(s)	258
PspFI	CCCAGC	1 cut(s)	152
PspN4I	GGNNCC	2 cut(s)	313, 436
PsuI	RGATCY	2 cut(s)	365, 434
RseI	CAYNNNNRTG	3 cut(s)	275, 411, 417
SaqAI	TTAA	1 cut(s)	92
SatI	GCNGC	1 cut(s)	257
Sau3AI	GATC	4 cut(s)	365, 409, 415, 434
SduI	GDGCHC	2 cut(s)	159, 375
SetI	ASST	2 cut(s)	106, 324
SmiMI	CAYNNNNRTG	3 cut(s)	275, 411, 417
Sse9I	AATT	3 cut(s)	220, 326, 387
SsiI	CCGC	1 cut(s)	69
SspMI	CTAG	1 cut(s)	359
StyI	CCWWGG	1 cut(s)	132
TaaI	ACNGT	3 cut(s)	31, 113, 277
TasI	AATT	3 cut(s)	220, 326, 387
Tru1I	TTAA	1 cut(s)	92
Tru9I	TTAA	1 cut(s)	92
TscAI	CASTG	3 cut(s)	282, 338, 445
TseFI	GTSAC	1 cut(s)	107
TseI	GCWGC	1 cut(s)	256
Tsp45I	GTSAC	1 cut(s)	107
TspDTI	ATGAA	4 cut(s)	23, 213, 276, 395
TspRI	CASTG	3 cut(s)	282, 338, 445
Van91I	CCANNNNNTGG	1 cut(s)	133
XapI	RAATTY	2 cut(s)	326, 387
XcmI	CCANNNNNNNNNTGG	1 cut(s)	139
XmnI	GAANNNNTTC	1 cut(s)	30
XspI	CTAG	1 cut(s)	359

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.