Rmu_sc0028630.1_g000001
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0028630.1
Physical Location & Seq
Reverse (-)
1 .. 2043
2043 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0028630.1_g000001.1.cds

Sequence Viewer

Length: 421 bp
atgtttgattatgtctttgattggacgatcttgaaatatcagcagtcgcagattgccacacctcctactcgtgctcctggtggtgctggaccaagctctggactgcctccagttgttgcaaatgttgaaagacaatcaggtggggaggaagttagacctactggttggtcgttggcagatccctcacgtaggagaaattctggaccgattgtaaatcctggaagcttgtctaaacaaaaaagtcctgttgcaaatgatccatctgtgtctaaagacgcaatgttatcaagttctagttttttgcggtcaactggatcatcaaggagggctgtagtttctagcagtcgggatgcagtaattgttggcagtgaatccgagccctctcgccctcaaaccacagaggcaagtcctggaacactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

140

Amino Acids

14.7

Weight (kDa)

9.68

Isoelectric Point (pI)

86.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017995)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 98
AciI CCGC 1 cut(s) 304
AclWI GGATC 3 cut(s) 173, 251, 322
AcsI RAATTY 1 cut(s) 196
AfiI CCNNNNNNNGG 2 cut(s) 98, 189
AgsI TTSAA 2 cut(s) 34, 128
AjnI CCWGG 3 cut(s) 76, 217, 409
AluBI AGCT 2 cut(s) 96, 225
AluI AGCT 2 cut(s) 96, 225
Alw21I GWGCWC 1 cut(s) 76
AlwI GGATC 3 cut(s) 173, 251, 322
ApoI RAATTY 1 cut(s) 196
AspS9I GGNCC 2 cut(s) 89, 203
AvaII GGWCC 2 cut(s) 89, 203
BanII GRGCYC 1 cut(s) 381
BauI CACGAG 1 cut(s) 69
Bbv12I GWGCWC 1 cut(s) 76
BccI CCATC 1 cut(s) 268
BciT130I CCWGG 3 cut(s) 78, 219, 411
BfaI CTAG 3 cut(s) 294, 339, 419
BfmI CTRYAG 1 cut(s) 330
Bme1390I CCNGG 3 cut(s) 78, 219, 411
Bme18I GGWCC 2 cut(s) 89, 203
BmgT120I GGNCC 2 cut(s) 89, 203
BmrFI CCNGG 3 cut(s) 78, 219, 411
BmsI GCATC 1 cut(s) 340
BpmI CTGGAG 1 cut(s) 93
BsaAI YACGTR 1 cut(s) 188
BsaXI ACNNNNNCTCC 2 cut(s) 58, 88
Bsc4I CCNNNNNNNGG 2 cut(s) 98, 189
Bse1I ACTGG 3 cut(s) 110, 166, 316
Bse3DI GCAATG 1 cut(s) 285
BseBI CCWGG 3 cut(s) 78, 219, 411
BseGI GGATG 1 cut(s) 355
BseLI CCNNNNNNNGG 2 cut(s) 98, 189
BseMI GCAATG 1 cut(s) 285
BseNI ACTGG 3 cut(s) 110, 166, 316
BsiHKAI GWGCWC 1 cut(s) 76
BslI CCNNNNNNNGG 2 cut(s) 98, 189
Bsp1286I GDGCHC 2 cut(s) 76, 381
Bsp143I GATC 4 cut(s) 27, 178, 256, 314
BspACI CCGC 1 cut(s) 304
BspPI GGATC 3 cut(s) 173, 251, 322
BsrDI GCAATG 1 cut(s) 285
BsrI ACTGG 3 cut(s) 110, 166, 316
BssMI GATC 4 cut(s) 27, 178, 256, 314
BssSI CACGAG 1 cut(s) 69
Bst2BI CACGAG 1 cut(s) 69
Bst2UI CCWGG 3 cut(s) 78, 219, 411
BstBAI YACGTR 1 cut(s) 188
BstENI CCTNNNNNAGG 1 cut(s) 187
BstF5I GGATG 1 cut(s) 355
BstKTI GATC 4 cut(s) 30, 181, 259, 317
BstMBI GATC 4 cut(s) 27, 178, 256, 314
BstNI CCWGG 3 cut(s) 78, 219, 411
BstSCI CCNGG 3 cut(s) 76, 217, 409
BstSFI CTRYAG 1 cut(s) 330
BstX2I RGATCY 1 cut(s) 178
BstYI RGATCY 1 cut(s) 178
BtsCI GGATG 1 cut(s) 355
BtsI GCAGTG 1 cut(s) 373
BtsIMutI CAGTG 1 cut(s) 373
Cfr13I GGNCC 2 cut(s) 89, 203
CseI GACGC 1 cut(s) 284
CviJI RGCY 4 cut(s) 96, 225, 329, 379
CviKI_1 RGCY 4 cut(s) 96, 225, 329, 379
DpnI GATC 4 cut(s) 29, 180, 258, 316
DpnII GATC 4 cut(s) 27, 178, 256, 314
Eco24I GRGCYC 1 cut(s) 381
Eco47I GGWCC 2 cut(s) 89, 203
EcoNI CCTNNNNNAGG 1 cut(s) 187
EcoRII CCWGG 3 cut(s) 76, 217, 409
EcoT38I GRGCYC 1 cut(s) 381
FaiI YATR 1 cut(s) 12
FokI GGATG 1 cut(s) 362
FriOI GRGCYC 1 cut(s) 381
FspBI CTAG 3 cut(s) 294, 339, 419
GsuI CTGGAG 1 cut(s) 93
HgaI GACGC 1 cut(s) 284
HincII GTYRAC 1 cut(s) 309
HindII GTYRAC 1 cut(s) 309
HindIII AAGCTT 1 cut(s) 223
HinfI GANTC 1 cut(s) 371
Hpy166II GTNNAC 1 cut(s) 309
Hpy188I TCNGA 1 cut(s) 376
Hpy188III TCNNGA 4 cut(s) 31, 99, 201, 347
Hpy8I GTNNAC 1 cut(s) 309
HpyCH4IV ACGT 1 cut(s) 187
HpyCH4V TGCA 3 cut(s) 119, 251, 353
HpySE526I ACGT 1 cut(s) 187
Kzo9I GATC 4 cut(s) 27, 178, 256, 314
LmnI GCTCC 1 cut(s) 79
LweI GCATC 1 cut(s) 340
MaeI CTAG 3 cut(s) 294, 339, 419
MaeII ACGT 1 cut(s) 187
MalI GATC 4 cut(s) 29, 180, 258, 316
MboI GATC 4 cut(s) 27, 178, 256, 314
MflI RGATCY 1 cut(s) 178
MhlI GDGCHC 2 cut(s) 76, 381
MluCI AATT 2 cut(s) 196, 357
MnlI CCTC 8 cut(s) 72, 117, 139, 193, 318, 391, 394, 399
MspR9I CCNGG 3 cut(s) 78, 219, 411
MvaI CCWGG 3 cut(s) 78, 219, 411
NdeII GATC 4 cut(s) 27, 178, 256, 314
PfeI GAWTC 1 cut(s) 371
PflMI CCANNNNNTGG 1 cut(s) 98
PfoI TCCNGGA 2 cut(s) 217, 409
Ppu21I YACGTR 1 cut(s) 188
Psp6I CCWGG 3 cut(s) 76, 217, 409
PspGI CCWGG 3 cut(s) 76, 217, 409
PspPI GGNCC 2 cut(s) 89, 203
PsuI RGATCY 1 cut(s) 178
Sau3AI GATC 4 cut(s) 27, 178, 256, 314
Sau96I GGNCC 2 cut(s) 89, 203
ScrFI CCNGG 3 cut(s) 78, 219, 411
SduI GDGCHC 2 cut(s) 76, 381
SetI ASST 6 cut(s) 64, 98, 142, 160, 190, 227
SfaNI GCATC 1 cut(s) 340
SfcI CTRYAG 1 cut(s) 330
SinI GGWCC 2 cut(s) 89, 203
Sse9I AATT 2 cut(s) 196, 357
SsiI CCGC 1 cut(s) 304
SspMI CTAG 3 cut(s) 294, 339, 419
StyD4I CCNGG 3 cut(s) 76, 217, 409
TaiI ACGT 1 cut(s) 190
TaqII GACCGA 1 cut(s) 220
TasI AATT 2 cut(s) 196, 357
TfiI GAWTC 1 cut(s) 371
TscAI CASTG 1 cut(s) 373
TspRI CASTG 1 cut(s) 373
Van91I CCANNNNNTGG 1 cut(s) 98
VpaK11BI GGWCC 2 cut(s) 89, 203
XagI CCTNNNNNAGG 1 cut(s) 187
XapI RAATTY 1 cut(s) 196
XspI CTAG 3 cut(s) 294, 339, 419
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.