Rh2DG457300
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Forward (+)
66068668 .. 66069819
1152 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG457300.1

Sequence Viewer

Length: 663 bp
ATGAGAAGATCAGTGAAAAGAAAGTGCTGTAGTGGTCTTTTTGTAGAGTTCTTAACATATTGCTGTCTTATTAGGCCAGGTTTTCAGTTTGATTATGTCTTTGATTGGACGATCTTGAAATATCAGCAGTCGCAGATTGCCACACCTTCTACTCGTGCTCCTGGTGGTGCTGGACCAAGCTCTGGACTGCCTCCAGTTGTTGCAAATGTTGAAAGACAATCAGGTGGGGAGGAAGTTAGACCTACTGGTTGGTCGTTGGCAGATCCCTCACGTAGGAGAAATTCTGGACCGATTGTAAATCCTGGAAGCTTGTCTAAACAAAAAAGTCCTGTTGCAAATGATCCATCTGTGTCTAAAGACGCAATGTTATCAAGTTCTAGTTTTTTGCGGTCAACTGGATCATCAAGGAGGGCTGTAGTTTCTAGCAGTCGGGATGCAGTAATTGTTGGCAGTGAATCCGAGCCCTCTCGCCCTCAAACCACAGAGGCAAGTCCTGGAACACTAGGTAAAATTTCTTCTATCCAAAGAAGTTCACCAGTTGTATCTTCAGAGCAGGATCGTACCACTTCTGGTAGAAATGTTTCGACCGTAAAAAACTTAGAGTCCACCCTCAGAGTTATTGAGACCCTTCATTTTAATAGCGACGAGAGAGTACAGTATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

220

Amino Acids

23.8

Weight (kDa)

9.77

Isoelectric Point (pI)

78.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017995)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 182
AciI CCGC 1 cut(s) 388
AclWI GGATC 4 cut(s) 257, 335, 406, 564
AcsI RAATTY 2 cut(s) 280, 510
AcuI CTGAAG 1 cut(s) 531
AfaI GTAC 2 cut(s) 562, 654
AfiI CCNNNNNNNGG 2 cut(s) 182, 273
AgsI TTSAA 2 cut(s) 118, 212
AjnI CCWGG 4 cut(s) 76, 160, 301, 493
AluBI AGCT 2 cut(s) 180, 309
AluI AGCT 2 cut(s) 180, 309
Alw21I GWGCWC 1 cut(s) 160
Alw26I GTCTC 1 cut(s) 617
AlwI GGATC 4 cut(s) 257, 335, 406, 564
AoxI GGCC 1 cut(s) 74
ApoI RAATTY 2 cut(s) 280, 510
Asp700I GAANNNNTTC 1 cut(s) 580
AspS9I GGNCC 2 cut(s) 173, 287
AsuHPI GGTGA 1 cut(s) 525
AvaII GGWCC 2 cut(s) 173, 287
BanII GRGCYC 1 cut(s) 465
BarI GAAGNNNNNNTAC 2 cut(s) 499, 531
BauI CACGAG 1 cut(s) 153
Bbv12I GWGCWC 1 cut(s) 160
BccI CCATC 1 cut(s) 352
BciT130I CCWGG 4 cut(s) 78, 162, 303, 495
BcoDI GTCTC 1 cut(s) 617
BfaI CTAG 3 cut(s) 378, 423, 503
BfmI CTRYAG 2 cut(s) 28, 414
Bme1390I CCNGG 4 cut(s) 78, 162, 303, 495
Bme18I GGWCC 2 cut(s) 173, 287
BmgT120I GGNCC 2 cut(s) 173, 287
BmrFI CCNGG 4 cut(s) 78, 162, 303, 495
BmsI GCATC 1 cut(s) 424
BpmI CTGGAG 1 cut(s) 177
BsaAI YACGTR 1 cut(s) 272
BsaI GGTCTC 1 cut(s) 617
BsaXI ACNNNNNCTCC 2 cut(s) 142, 172
Bsc4I CCNNNNNNNGG 2 cut(s) 182, 273
Bse1I ACTGG 4 cut(s) 194, 250, 400, 536
Bse3DI GCAATG 1 cut(s) 369
BseBI CCWGG 4 cut(s) 78, 162, 303, 495
BseGI GGATG 1 cut(s) 439
BseLI CCNNNNNNNGG 2 cut(s) 182, 273
BseMI GCAATG 1 cut(s) 369
BseMII CTCAG 1 cut(s) 625
BseNI ACTGG 4 cut(s) 194, 250, 400, 536
Bsh1285I CGRYCG 1 cut(s) 588
BshFI GGCC 1 cut(s) 76
BsiEI CGRYCG 1 cut(s) 588
BsiHKAI GWGCWC 1 cut(s) 160
BslI CCNNNNNNNGG 2 cut(s) 182, 273
BsmAI GTCTC 1 cut(s) 617
BsnI GGCC 1 cut(s) 76
Bso31I GGTCTC 1 cut(s) 617
Bsp1286I GDGCHC 2 cut(s) 160, 465
Bsp143I GATC 6 cut(s) 8, 111, 262, 340, 398, 556
BspACI CCGC 1 cut(s) 388
BspANI GGCC 1 cut(s) 76
BspCNI CTCAG 1 cut(s) 624
BspPI GGATC 4 cut(s) 257, 335, 406, 564
BspTNI GGTCTC 1 cut(s) 617
BsrDI GCAATG 1 cut(s) 369
BsrI ACTGG 4 cut(s) 194, 250, 400, 536
BssMI GATC 6 cut(s) 8, 111, 262, 340, 398, 556
BssSI CACGAG 1 cut(s) 153
Bst2BI CACGAG 1 cut(s) 153
Bst2UI CCWGG 4 cut(s) 78, 162, 303, 495
Bst4CI ACNGT 2 cut(s) 589, 657
BstBAI YACGTR 1 cut(s) 272
BstDEI CTNAG 2 cut(s) 598, 611
BstENI CCTNNNNNAGG 1 cut(s) 271
BstF5I GGATG 1 cut(s) 439
BstKTI GATC 6 cut(s) 11, 114, 265, 343, 401, 559
BstMAI GTCTC 1 cut(s) 617
BstMBI GATC 6 cut(s) 8, 111, 262, 340, 398, 556
BstMCI CGRYCG 1 cut(s) 588
BstNI CCWGG 4 cut(s) 78, 162, 303, 495
BstSCI CCNGG 4 cut(s) 76, 160, 301, 493
BstSFI CTRYAG 2 cut(s) 28, 414
BstX2I RGATCY 1 cut(s) 262
BstYI RGATCY 1 cut(s) 262
BsuRI GGCC 1 cut(s) 76
BtsCI GGATG 1 cut(s) 439
BtsI GCAGTG 1 cut(s) 457
BtsIMutI CAGTG 2 cut(s) 18, 457
Cfr13I GGNCC 2 cut(s) 173, 287
CseI GACGC 1 cut(s) 368
Csp6I GTAC 2 cut(s) 561, 653
CviJI RGCY 5 cut(s) 76, 180, 309, 413, 463
CviKI_1 RGCY 5 cut(s) 76, 180, 309, 413, 463
CviQI GTAC 2 cut(s) 561, 653
DdeI CTNAG 2 cut(s) 598, 611
DpnI GATC 6 cut(s) 10, 113, 264, 342, 400, 558
DpnII GATC 6 cut(s) 8, 111, 262, 340, 398, 556
Eco24I GRGCYC 1 cut(s) 465
Eco31I GGTCTC 1 cut(s) 617
Eco47I GGWCC 2 cut(s) 173, 287
Eco57I CTGAAG 1 cut(s) 531
EcoNI CCTNNNNNAGG 1 cut(s) 271
EcoRII CCWGG 4 cut(s) 76, 160, 301, 493
EcoT38I GRGCYC 1 cut(s) 465
FaiI YATR 2 cut(s) 58, 96
FokI GGATG 1 cut(s) 446
FriOI GRGCYC 1 cut(s) 465
FspBI CTAG 3 cut(s) 378, 423, 503
GsuI CTGGAG 1 cut(s) 177
HaeIII GGCC 1 cut(s) 76
HgaI GACGC 1 cut(s) 368
HincII GTYRAC 1 cut(s) 393
HindII GTYRAC 1 cut(s) 393
HindIII AAGCTT 1 cut(s) 307
HinfI GANTC 2 cut(s) 455, 602
HphI GGTGA 1 cut(s) 525
Hpy166II GTNNAC 3 cut(s) 393, 533, 606
Hpy188I TCNGA 3 cut(s) 460, 550, 614
Hpy188III TCNNGA 4 cut(s) 115, 183, 285, 431
Hpy8I GTNNAC 3 cut(s) 393, 533, 606
Hpy99I CGWCG 1 cut(s) 647
HpyAV CCTTC 2 cut(s) 156, 638
HpyCH4III ACNGT 2 cut(s) 589, 657
HpyCH4IV ACGT 1 cut(s) 271
HpyCH4V TGCA 3 cut(s) 203, 335, 437
HpyF3I CTNAG 2 cut(s) 598, 611
HpySE526I ACGT 1 cut(s) 271
Kzo9I GATC 6 cut(s) 8, 111, 262, 340, 398, 556
LmnI GCTCC 1 cut(s) 163
LweI GCATC 1 cut(s) 424
MaeI CTAG 3 cut(s) 378, 423, 503
MaeII ACGT 1 cut(s) 271
MalI GATC 6 cut(s) 10, 113, 264, 342, 400, 558
MboI GATC 6 cut(s) 8, 111, 262, 340, 398, 556
MboII GAAGA 3 cut(s) 18, 507, 537
MflI RGATCY 1 cut(s) 262
MhlI GDGCHC 2 cut(s) 160, 465
MluCI AATT 3 cut(s) 280, 441, 510
MlyI GAGTC 1 cut(s) 611
MnlI CCTC 8 cut(s) 201, 223, 277, 402, 475, 478, 483, 620
MroXI GAANNNNTTC 1 cut(s) 580
MseI TTAA 2 cut(s) 53, 636
MspR9I CCNGG 4 cut(s) 78, 162, 303, 495
MvaI CCWGG 4 cut(s) 78, 162, 303, 495
NdeII GATC 6 cut(s) 8, 111, 262, 340, 398, 556
PdmI GAANNNNTTC 1 cut(s) 580
PfeI GAWTC 1 cut(s) 455
PflMI CCANNNNNTGG 1 cut(s) 182
PfoI TCCNGGA 2 cut(s) 301, 493
PleI GAGTC 1 cut(s) 610
PpsI GAGTC 1 cut(s) 610
Ppu21I YACGTR 1 cut(s) 272
Psp6I CCWGG 4 cut(s) 76, 160, 301, 493
PspGI CCWGG 4 cut(s) 76, 160, 301, 493
PspPI GGNCC 2 cut(s) 173, 287
PsuI RGATCY 1 cut(s) 262
RsaI GTAC 2 cut(s) 562, 654
RsaNI GTAC 2 cut(s) 561, 653
SaqAI TTAA 2 cut(s) 53, 636
Sau3AI GATC 6 cut(s) 8, 111, 262, 340, 398, 556
Sau96I GGNCC 2 cut(s) 173, 287
SchI GAGTC 1 cut(s) 611
ScrFI CCNGG 4 cut(s) 78, 162, 303, 495
SduI GDGCHC 2 cut(s) 160, 465
SetI ASST 8 cut(s) 82, 148, 182, 226, 244, 274, 311, 508
SfaNI GCATC 1 cut(s) 424
SfcI CTRYAG 2 cut(s) 28, 414
SinI GGWCC 2 cut(s) 173, 287
Sse9I AATT 3 cut(s) 280, 441, 510
SsiI CCGC 1 cut(s) 388
SspMI CTAG 3 cut(s) 378, 423, 503
StyD4I CCNGG 4 cut(s) 76, 160, 301, 493
TaaI ACNGT 2 cut(s) 589, 657
TaiI ACGT 1 cut(s) 274
TaqI TCGA 1 cut(s) 584
TaqII GACCGA 1 cut(s) 304
TasI AATT 3 cut(s) 280, 441, 510
TatI WGTACW 1 cut(s) 652
TfiI GAWTC 1 cut(s) 455
Tru1I TTAA 2 cut(s) 53, 636
Tru9I TTAA 2 cut(s) 53, 636
TscAI CASTG 2 cut(s) 18, 457
TspDTI ATGAA 1 cut(s) 620
TspRI CASTG 2 cut(s) 18, 457
Van91I CCANNNNNTGG 1 cut(s) 182
VpaK11BI GGWCC 2 cut(s) 173, 287
XagI CCTNNNNNAGG 1 cut(s) 271
XapI RAATTY 2 cut(s) 280, 510
XmnI GAANNNNTTC 1 cut(s) 580
XspI CTAG 3 cut(s) 378, 423, 503
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.