Rh2BG448000
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Forward (+)
63238228 .. 63244409
6182 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG448000.1

Sequence Viewer

Length: 405 bp
ATGGAGAACAGAGTCCACAAACAACGAAATATTACATCCACATATGGTGGCATATCATCATCATCAAGTTTTCAGTTTGATTATGTCTTTGATTGGATGATCTTGAAATATCAGCAGTCGCAGATTGCCACACCTCCTACTCGTGCTCCTGGTGGTGCTGGACCAAGCTCTGGACTGCCTCCAGTTGTTGCAAATGTTGAAAGACAATCAGGTGGGGAGGAAGTTAGACCTACTGGTTGGTCGTTGGCAGATCCCTCACGTAGGAGAAATTCTGGACCGATTGTAAATCCTGGAAGCTTGTCTAAACAAAAAAGTCCTGTTGCAAACGATCCATCTGTGTCTAAAGACGCAATGTTATCAAGTTCTAGTTTTTTGCGGTCAACTGGATCATCAAGGGGGCTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

134

Amino Acids

14.31

Weight (kDa)

10.19

Isoelectric Point (pI)

82.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017995)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 170
AciI CCGC 1 cut(s) 376
AclWI GGATC 3 cut(s) 245, 323, 394
AcsI RAATTY 1 cut(s) 268
AfiI CCNNNNNNNGG 2 cut(s) 170, 261
AgsI TTSAA 2 cut(s) 106, 200
AjnI CCWGG 2 cut(s) 148, 289
AluBI AGCT 2 cut(s) 168, 297
AluI AGCT 2 cut(s) 168, 297
Alw21I GWGCWC 1 cut(s) 148
AlwI GGATC 3 cut(s) 245, 323, 394
ApoI RAATTY 1 cut(s) 268
AspS9I GGNCC 2 cut(s) 161, 275
AvaII GGWCC 2 cut(s) 161, 275
BauI CACGAG 1 cut(s) 141
Bbv12I GWGCWC 1 cut(s) 148
BccI CCATC 1 cut(s) 340
BciT130I CCWGG 2 cut(s) 150, 291
BfaI CTAG 1 cut(s) 366
BfmI CTRYAG 1 cut(s) 401
Bme1390I CCNGG 2 cut(s) 150, 291
Bme18I GGWCC 2 cut(s) 161, 275
BmgT120I GGNCC 2 cut(s) 161, 275
BmrFI CCNGG 2 cut(s) 150, 291
BpmI CTGGAG 1 cut(s) 165
BsaAI YACGTR 1 cut(s) 260
BsaXI ACNNNNNCTCC 2 cut(s) 130, 160
Bsc4I CCNNNNNNNGG 2 cut(s) 170, 261
Bse1I ACTGG 3 cut(s) 182, 238, 388
Bse3DI GCAATG 1 cut(s) 357
BseBI CCWGG 2 cut(s) 150, 291
BseGI GGATG 2 cut(s) 35, 102
BseLI CCNNNNNNNGG 2 cut(s) 170, 261
BseMI GCAATG 1 cut(s) 357
BseNI ACTGG 3 cut(s) 182, 238, 388
BsiHKAI GWGCWC 1 cut(s) 148
BslI CCNNNNNNNGG 2 cut(s) 170, 261
Bsp1286I GDGCHC 1 cut(s) 148
Bsp143I GATC 4 cut(s) 99, 250, 328, 386
BspACI CCGC 1 cut(s) 376
BspPI GGATC 3 cut(s) 245, 323, 394
BsrDI GCAATG 1 cut(s) 357
BsrI ACTGG 3 cut(s) 182, 238, 388
BssMI GATC 4 cut(s) 99, 250, 328, 386
BssSI CACGAG 1 cut(s) 141
Bst2BI CACGAG 1 cut(s) 141
Bst2UI CCWGG 2 cut(s) 150, 291
BstBAI YACGTR 1 cut(s) 260
BstENI CCTNNNNNAGG 1 cut(s) 259
BstF5I GGATG 2 cut(s) 35, 102
BstKTI GATC 4 cut(s) 102, 253, 331, 389
BstMBI GATC 4 cut(s) 99, 250, 328, 386
BstNI CCWGG 2 cut(s) 150, 291
BstSCI CCNGG 2 cut(s) 148, 289
BstSFI CTRYAG 1 cut(s) 401
BstX2I RGATCY 1 cut(s) 250
BstYI RGATCY 1 cut(s) 250
BtsCI GGATG 2 cut(s) 35, 102
Cfr13I GGNCC 2 cut(s) 161, 275
CseI GACGC 1 cut(s) 356
CviJI RGCY 3 cut(s) 168, 297, 400
CviKI_1 RGCY 3 cut(s) 168, 297, 400
DpnI GATC 4 cut(s) 101, 252, 330, 388
DpnII GATC 4 cut(s) 99, 250, 328, 386
Eco47I GGWCC 2 cut(s) 161, 275
EcoNI CCTNNNNNAGG 1 cut(s) 259
EcoRII CCWGG 2 cut(s) 148, 289
FaiI YATR 4 cut(s) 43, 45, 53, 84
FauNDI CATATG 1 cut(s) 43
FokI GGATG 2 cut(s) 22, 109
FspBI CTAG 1 cut(s) 366
GsuI CTGGAG 1 cut(s) 165
HgaI GACGC 1 cut(s) 356
HincII GTYRAC 1 cut(s) 381
HindII GTYRAC 1 cut(s) 381
HindIII AAGCTT 1 cut(s) 295
HinfI GANTC 1 cut(s) 12
Hpy166II GTNNAC 2 cut(s) 16, 381
Hpy188III TCNNGA 3 cut(s) 103, 171, 273
Hpy8I GTNNAC 2 cut(s) 16, 381
HpyCH4IV ACGT 1 cut(s) 259
HpyCH4V TGCA 2 cut(s) 191, 323
HpySE526I ACGT 1 cut(s) 259
Kzo9I GATC 4 cut(s) 99, 250, 328, 386
LmnI GCTCC 1 cut(s) 151
MaeI CTAG 1 cut(s) 366
MaeII ACGT 1 cut(s) 259
MalI GATC 4 cut(s) 101, 252, 330, 388
MboI GATC 4 cut(s) 99, 250, 328, 386
MflI RGATCY 1 cut(s) 250
MhlI GDGCHC 1 cut(s) 148
MluCI AATT 1 cut(s) 268
MlyI GAGTC 1 cut(s) 21
MnlI CCTC 4 cut(s) 144, 189, 211, 265
MspR9I CCNGG 2 cut(s) 150, 291
MvaI CCWGG 2 cut(s) 150, 291
NdeI CATATG 1 cut(s) 43
NdeII GATC 4 cut(s) 99, 250, 328, 386
PflMI CCANNNNNTGG 1 cut(s) 170
PfoI TCCNGGA 1 cut(s) 289
PleI GAGTC 1 cut(s) 20
PpsI GAGTC 1 cut(s) 20
Ppu21I YACGTR 1 cut(s) 260
Psp6I CCWGG 2 cut(s) 148, 289
PspGI CCWGG 2 cut(s) 148, 289
PspPI GGNCC 2 cut(s) 161, 275
PsuI RGATCY 1 cut(s) 250
Sau3AI GATC 4 cut(s) 99, 250, 328, 386
Sau96I GGNCC 2 cut(s) 161, 275
SchI GAGTC 1 cut(s) 21
ScrFI CCNGG 2 cut(s) 150, 291
SduI GDGCHC 1 cut(s) 148
SetI ASST 6 cut(s) 136, 170, 214, 232, 262, 299
SfcI CTRYAG 1 cut(s) 401
SinI GGWCC 2 cut(s) 161, 275
Sse9I AATT 1 cut(s) 268
SsiI CCGC 1 cut(s) 376
SspI AATATT 1 cut(s) 31
SspMI CTAG 1 cut(s) 366
StyD4I CCNGG 2 cut(s) 148, 289
TaiI ACGT 1 cut(s) 262
TaqII GACCGA 1 cut(s) 292
TasI AATT 1 cut(s) 268
Van91I CCANNNNNTGG 1 cut(s) 170
VpaK11BI GGWCC 2 cut(s) 161, 275
XagI CCTNNNNNAGG 1 cut(s) 259
XapI RAATTY 1 cut(s) 268
XspI CTAG 1 cut(s) 366
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.