Rmu_sc0030772.1_g000001

Belongs to the eukaryotic-type primase small subunit family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0030772.1
Physical Location & Seq
Forward (+)
1 .. 501
501 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0030772.1_g000001.1.cds

Sequence Viewer

Length: 271 bp
aaagatattttctactgcagagagatatgaaaagatcttagatatgattcctgatgaatctgtcacttctgagcttcggggaaagtggcaagataatagacgaacctccaatgcaaaagaagacattaatgttgctcgttgggagcagctgaaacatttgctgcaatctgggaaacagaagatgcaaggactgcgtagatgtgtggaggagattgtgttctcttatacctaccctagacttgacatggaggtttgcacgacaaccccctga

Protein Analysis

89

Amino Acids

10.54

Weight (kDa)

7.97

Isoelectric Point (pI)

58.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017377)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AloI GAACNNNNNNTCC 2 cut(s) 201, 233
AluBI AGCT 2 cut(s) 74, 149
AluI AGCT 2 cut(s) 74, 149
ApeKI GCWGC 2 cut(s) 146, 161
AseI ATTAAT 1 cut(s) 127
BbsI GAAGAC 1 cut(s) 127
BbvI GCAGC 2 cut(s) 148, 158
BfaI CTAG 1 cut(s) 235
BfmI CTRYAG 1 cut(s) 16
BglII AGATCT 1 cut(s) 34
BisI GCNGC 2 cut(s) 147, 162
BlsI GCNGC 2 cut(s) 148, 163
BmsI GCATC 1 cut(s) 172
BpiI GAAGAC 1 cut(s) 127
BsaXI ACNNNNNCTCC 2 cut(s) 201, 231
BseMII CTCAG 1 cut(s) 61
BseRI GAGGAG 1 cut(s) 222
BseXI GCAGC 2 cut(s) 148, 158
Bsp143I GATC 1 cut(s) 34
BspCNI CTCAG 1 cut(s) 62
BspMAI CTGCAG 1 cut(s) 20
BssMI GATC 1 cut(s) 34
BstAPI GCANNNNNTGC 1 cut(s) 191
BstDEI CTNAG 2 cut(s) 38, 70
BstKTI GATC 1 cut(s) 37
BstMBI GATC 1 cut(s) 34
BstMWI GCNNNNNNNGC 1 cut(s) 191
BstSFI CTRYAG 1 cut(s) 16
BstV1I GCAGC 2 cut(s) 148, 158
BstV2I GAAGAC 1 cut(s) 127
BstX2I RGATCY 1 cut(s) 34
BstYI RGATCY 1 cut(s) 34
CviAII CATG 1 cut(s) 245
CviJI RGCY 2 cut(s) 74, 149
CviKI_1 RGCY 2 cut(s) 74, 149
DdeI CTNAG 2 cut(s) 38, 70
DpnI GATC 1 cut(s) 36
DpnII GATC 1 cut(s) 34
FaeI CATG 1 cut(s) 248
FaiI YATR 4 cut(s) 28, 45, 226, 246
FatI CATG 1 cut(s) 244
Fnu4HI GCNGC 2 cut(s) 147, 162
Fsp4HI GCNGC 2 cut(s) 147, 162
FspBI CTAG 1 cut(s) 235
GluI GCNGC 2 cut(s) 147, 162
Hin1II CATG 1 cut(s) 248
HinfI GANTC 2 cut(s) 47, 57
Hpy188I TCNGA 1 cut(s) 71
Hpy188III TCNNGA 1 cut(s) 51
HpyCH4V TGCA 5 cut(s) 18, 114, 164, 185, 256
HpyF10VI GCNNNNNNNGC 1 cut(s) 191
HpyF3I CTNAG 2 cut(s) 38, 70
Hsp92II CATG 1 cut(s) 248
Kzo9I GATC 1 cut(s) 34
LmnI GCTCC 1 cut(s) 143
LpnPI CCDG 2 cut(s) 64, 154
Lsp1109I GCAGC 2 cut(s) 148, 158
LweI GCATC 1 cut(s) 172
MaeI CTAG 1 cut(s) 235
MaeIII GTNAC 1 cut(s) 62
MalI GATC 1 cut(s) 36
MboI GATC 1 cut(s) 34
MboII GAAGA 2 cut(s) 132, 191
MflI RGATCY 1 cut(s) 34
MnlI CCTC 3 cut(s) 116, 200, 242
MseI TTAA 1 cut(s) 127
MspA1I CMGCKG 1 cut(s) 149
MwoI GCNNNNNNNGC 1 cut(s) 191
NdeII GATC 1 cut(s) 34
NlaIII CATG 1 cut(s) 248
NmuCI GTSAC 1 cut(s) 62
PfeI GAWTC 2 cut(s) 47, 57
PkrI GCNGC 2 cut(s) 148, 163
PshBI ATTAAT 1 cut(s) 127
PstI CTGCAG 1 cut(s) 20
PsuI RGATCY 1 cut(s) 34
PvuII CAGCTG 1 cut(s) 149
SaqAI TTAA 1 cut(s) 127
SatI GCNGC 2 cut(s) 147, 162
Sau3AI GATC 1 cut(s) 34
SetI ASST 5 cut(s) 76, 108, 151, 231, 253
SfaNI GCATC 1 cut(s) 172
SfcI CTRYAG 1 cut(s) 16
SgeI CNNG 9 cut(s) 63, 90, 102, 148, 181, 198, 247, 252, 257
SspMI CTAG 1 cut(s) 235
TfiI GAWTC 2 cut(s) 47, 57
Tru1I TTAA 1 cut(s) 127
Tru9I TTAA 1 cut(s) 127
TseFI GTSAC 1 cut(s) 62
TseI GCWGC 2 cut(s) 146, 161
Tsp45I GTSAC 1 cut(s) 62
TspDTI ATGAA 2 cut(s) 43, 70
VspI ATTAAT 1 cut(s) 127
XspI CTAG 1 cut(s) 235
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.