Rmu_sc0031170.1_g000001

LRR-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0031170.1
Physical Location & Seq
Forward (+)
1 .. 1244
1244 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0031170.1_g000001.1.cds

Sequence Viewer

Length: 571 bp
tgtaagcagagctaaagttctcgctttgatcggagacatcataaaggttgtgttcagggaaggcttcatgagaccacccttagataatgtttattgcttttctatacttgggacgttgactgacgaccttgtcccacctatggccaatcttcttaaaacagtgcctaatttgattagtttgcgcataagtaatgcagtcatccctctcaactctagtactaattcatctgggttcaatatcagttattggaaatccctgaacctggcttttgttgatcatcttgagtacgtatcaataccaattttcaacggagataatgaggtggagtttgcagcttatttgcttgaaaatgctaggaatttgaagagaatggtcatttaccactcaggccaacatggtgctataaagtggcttcaaaataaaagcttctgctattccactgccaatgttatctttatggaaccagtcaagcagttaatcaagaaaacaaaggaaacagaaaggagtacgtatggccattctattgaaatggaaaactcggatgttgatatgttttggtcagactcttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

189

Amino Acids

21.4

Weight (kDa)

6.47

Isoelectric Point (pI)

29.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 129
Acc16I TGCGCA 1 cut(s) 183
AcoI YGGCCR 2 cut(s) 142, 515
AcsI RAATTY 1 cut(s) 359
AfaI GTAC 3 cut(s) 218, 288, 509
AfiI CCNNNNNNNGG 2 cut(s) 140, 263
AgsI TTSAA 6 cut(s) 236, 308, 348, 365, 417, 528
AjnI CCWGG 1 cut(s) 262
AluBI AGCT 3 cut(s) 12, 336, 427
AluI AGCT 3 cut(s) 12, 336, 427
Alw26I GTCTC 2 cut(s) 28, 65
AoxI GGCC 3 cut(s) 142, 389, 515
ApeKI GCWGC 1 cut(s) 333
ApoI RAATTY 1 cut(s) 359
AspLEI GCGC 1 cut(s) 184
BalI TGGCCA 2 cut(s) 144, 517
BbvI GCAGC 1 cut(s) 345
BciT130I CCWGG 1 cut(s) 264
BclI TGATCA 1 cut(s) 275
BcoDI GTCTC 2 cut(s) 28, 65
BfaI CTAG 2 cut(s) 214, 355
BisI GCNGC 1 cut(s) 334
BlsI GCNGC 1 cut(s) 335
BmcAI AGTACT 1 cut(s) 218
Bme1390I CCNGG 1 cut(s) 264
BmiI GGNNCC 1 cut(s) 463
BmrFI CCNGG 1 cut(s) 264
BpuEI CTTGAG 1 cut(s) 303
BsaAI YACGTR 2 cut(s) 290, 511
BsaI GGTCTC 1 cut(s) 65
Bsc4I CCNNNNNNNGG 2 cut(s) 140, 263
Bse1I ACTGG 1 cut(s) 465
BseBI CCWGG 1 cut(s) 264
BseGI GGATG 2 cut(s) 199, 548
BseLI CCNNNNNNNGG 2 cut(s) 140, 263
BseMII CTCAG 1 cut(s) 400
BseNI ACTGG 1 cut(s) 465
BseXI GCAGC 1 cut(s) 345
BshFI GGCC 3 cut(s) 144, 391, 517
BslFI GGGAC 2 cut(s) 117, 125
BslI CCNNNNNNNGG 2 cut(s) 140, 263
BsmAI GTCTC 2 cut(s) 28, 65
BsmFI GGGAC 2 cut(s) 117, 125
BsnI GGCC 3 cut(s) 144, 391, 517
Bso31I GGTCTC 1 cut(s) 65
Bsp143I GATC 2 cut(s) 28, 275
BspANI GGCC 3 cut(s) 144, 391, 517
BspCNI CTCAG 1 cut(s) 399
BspHI TCATGA 1 cut(s) 67
BspLI GGNNCC 1 cut(s) 463
BspTNI GGTCTC 1 cut(s) 65
BsrI ACTGG 1 cut(s) 465
BssMI GATC 2 cut(s) 28, 275
Bst2UI CCWGG 1 cut(s) 264
Bst4CI ACNGT 1 cut(s) 161
Bst6I CTCTTC 1 cut(s) 360
BstBAI YACGTR 2 cut(s) 290, 511
BstDEI CTNAG 2 cut(s) 80, 386
BstF5I GGATG 2 cut(s) 199, 548
BstHHI GCGC 1 cut(s) 184
BstKTI GATC 2 cut(s) 31, 278
BstMAI GTCTC 2 cut(s) 28, 65
BstMBI GATC 2 cut(s) 28, 275
BstNI CCWGG 1 cut(s) 264
BstSCI CCNGG 1 cut(s) 262
BstSNI TACGTA 2 cut(s) 290, 511
BstV1I GCAGC 1 cut(s) 345
BsuRI GGCC 3 cut(s) 144, 391, 517
BtsCI GGATG 2 cut(s) 199, 548
BtsI GCAGTG 1 cut(s) 439
BtsIMutI CAGTG 2 cut(s) 166, 439
CciI TCATGA 1 cut(s) 67
CfoI GCGC 1 cut(s) 184
Csp6I GTAC 3 cut(s) 217, 287, 508
CviAII CATG 2 cut(s) 68, 396
CviJI RGCY 9 cut(s) 12, 64, 144, 267, 336, 391, 413, 427, 517
CviKI_1 RGCY 9 cut(s) 12, 64, 144, 267, 336, 391, 413, 427, 517
CviQI GTAC 3 cut(s) 217, 287, 508
DdeI CTNAG 2 cut(s) 80, 386
DpnI GATC 2 cut(s) 30, 277
DpnII GATC 2 cut(s) 28, 275
DrdI GACNNNNNNGTC 1 cut(s) 129
DseDI GACNNNNNNGTC 1 cut(s) 129
EaeI YGGCCR 2 cut(s) 142, 515
Eam1104I CTCTTC 1 cut(s) 360
EarI CTCTTC 1 cut(s) 360
Eco105I TACGTA 2 cut(s) 290, 511
Eco31I GGTCTC 1 cut(s) 65
EcoRII CCWGG 1 cut(s) 262
FaeI CATG 2 cut(s) 71, 399
FaqI GGGAC 2 cut(s) 117, 125
FatI CATG 2 cut(s) 67, 395
FbaI TGATCA 1 cut(s) 275
Fnu4HI GCNGC 1 cut(s) 334
FokI GGATG 2 cut(s) 186, 555
Fsp4HI GCNGC 1 cut(s) 334
FspBI CTAG 2 cut(s) 214, 355
FspI TGCGCA 1 cut(s) 183
GlaI GCGC 1 cut(s) 183
GluI GCNGC 1 cut(s) 334
HaeIII GGCC 3 cut(s) 144, 391, 517
HhaI GCGC 1 cut(s) 184
Hin1II CATG 2 cut(s) 71, 399
Hin6I GCGC 1 cut(s) 182
HinP1I GCGC 1 cut(s) 182
HincII GTYRAC 1 cut(s) 118
HindII GTYRAC 1 cut(s) 118
HindIII AAGCTT 1 cut(s) 425
HinfI GANTC 1 cut(s) 564
Hpy166II GTNNAC 1 cut(s) 118
Hpy188I TCNGA 3 cut(s) 33, 542, 563
Hpy188III TCNNGA 4 cut(s) 68, 282, 482, 568
Hpy8I GTNNAC 1 cut(s) 118
HpyAV CCTTC 1 cut(s) 54
HpyCH4III ACNGT 1 cut(s) 161
HpyCH4IV ACGT 3 cut(s) 114, 289, 510
HpyCH4V TGCA 2 cut(s) 195, 333
HpyF3I CTNAG 2 cut(s) 80, 386
HpySE526I ACGT 3 cut(s) 114, 289, 510
Hsp92II CATG 2 cut(s) 71, 399
HspAI GCGC 1 cut(s) 182
Ksp22I TGATCA 1 cut(s) 275
Kzo9I GATC 2 cut(s) 28, 275
LpnPI CCDG 7 cut(s) 41, 214, 249, 270, 276, 373, 478
Lsp1109I GCAGC 1 cut(s) 345
MaeI CTAG 2 cut(s) 214, 355
MaeII ACGT 3 cut(s) 114, 289, 510
MalI GATC 2 cut(s) 30, 277
MboI GATC 2 cut(s) 28, 275
MboII GAAGA 2 cut(s) 141, 377
MlsI TGGCCA 2 cut(s) 144, 517
MluCI AATT 4 cut(s) 167, 221, 301, 359
MluNI TGGCCA 2 cut(s) 144, 517
MlyI GAGTC 1 cut(s) 558
MnlI CCTC 2 cut(s) 214, 314
Mox20I TGGCCA 2 cut(s) 144, 517
MscI TGGCCA 2 cut(s) 144, 517
MseI TTAA 2 cut(s) 154, 477
Msp20I TGGCCA 2 cut(s) 144, 517
MspR9I CCNGG 1 cut(s) 264
MvaI CCWGG 1 cut(s) 264
NdeII GATC 2 cut(s) 28, 275
NlaIII CATG 2 cut(s) 71, 399
NlaIV GGNNCC 1 cut(s) 463
NsbI TGCGCA 1 cut(s) 183
PagI TCATGA 1 cut(s) 67
PflFI GACNNNGTC 1 cut(s) 129
PkrI GCNGC 1 cut(s) 335
PleI GAGTC 1 cut(s) 558
PpsI GAGTC 1 cut(s) 558
Ppu21I YACGTR 2 cut(s) 290, 511
Psp6I CCWGG 1 cut(s) 262
PspGI CCWGG 1 cut(s) 262
PspN4I GGNNCC 1 cut(s) 463
PsyI GACNNNGTC 1 cut(s) 129
RsaI GTAC 3 cut(s) 218, 288, 509
RsaNI GTAC 3 cut(s) 217, 287, 508
SaqAI TTAA 2 cut(s) 154, 477
SatI GCNGC 1 cut(s) 334
Sau3AI GATC 2 cut(s) 28, 275
ScaI AGTACT 1 cut(s) 218
SchI GAGTC 1 cut(s) 558
ScrFI CCNGG 1 cut(s) 264
SmlI CTYRAG 1 cut(s) 282
SmoI CTYRAG 1 cut(s) 282
SnaBI TACGTA 2 cut(s) 290, 511
Sse9I AATT 4 cut(s) 167, 221, 301, 359
SspMI CTAG 2 cut(s) 214, 355
StyD4I CCNGG 1 cut(s) 262
TaaI ACNGT 1 cut(s) 161
TaiI ACGT 3 cut(s) 117, 292, 513
TasI AATT 4 cut(s) 167, 221, 301, 359
TatI WGTACW 1 cut(s) 216
Tru1I TTAA 2 cut(s) 154, 477
Tru9I TTAA 2 cut(s) 154, 477
TscAI CASTG 2 cut(s) 166, 446
TseI GCWGC 1 cut(s) 333
TspDTI ATGAA 2 cut(s) 56, 214
TspGWI ACGGA 1 cut(s) 325
TspRI CASTG 2 cut(s) 166, 446
Tth111I GACNNNGTC 1 cut(s) 129
XapI RAATTY 1 cut(s) 359
XspI CTAG 2 cut(s) 214, 355
ZrmI AGTACT 1 cut(s) 218
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.