Rmu_sc0040727.1_g000001

BP28CT (NUC211) domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0040727.1
Physical Location & Seq
Reverse (-)
1 .. 1965
1965 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0040727.1_g000001.1.cds

Sequence Viewer

Length: 674 bp
atgctgaattgggattgcagcagatttcttgataagctagattccaatttgaaagcaataaatgcaaatattctaatttgcatcttttggaggttgatggaggcatttctatctgcgatgcctgcagatgtctcattggatggtgatgggaagtgggttagctggctcagggaattgtttgccttcttctcaggctgtcagtttaagaacatatttaaggagcaccgtcattacgttgtcacaaagtgcaagatatctgctgtttctttccttgccaagtttttcacagaagaagacgttcctgttgcagtccaggtcgagagtcttcactgtttttcctatctgtgtcttcaatcagaagttagattgccaattcaatttcttgctgaatttccatctcttcttgttccactggctagttgtaaccaggagataagaaatgttgccatgaattgtgttgagggtttacagaccttttcatctcatgttgactctttgagcaagaaaaatggaaaccgtgcaattcggattaatcatcttgataagctgctggacttgttggtccagcagaaaaggctaatcctatcggacaggaacttgcttccttctctcttggcctctttgctcagcccgtccttccagagcttcttaggaccaaagaatattgagataag

Protein Analysis

224

Amino Acids

25.52

Weight (kDa)

7.57

Isoelectric Point (pI)

50.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018531)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 560
AcsI RAATTY 1 cut(s) 389
AdeI CACNNNGTG 1 cut(s) 246
AgsI TTSAA 3 cut(s) 52, 353, 377
AjnI CCWGG 2 cut(s) 312, 426
AluBI AGCT 4 cut(s) 37, 162, 547, 645
AluI AGCT 4 cut(s) 37, 162, 547, 645
Alw21I GWGCWC 1 cut(s) 225
Alw26I GTCTC 1 cut(s) 136
AoxI GGCC 1 cut(s) 615
ApeKI GCWGC 2 cut(s) 18, 547
ApoI RAATTY 1 cut(s) 389
AseI ATTAAT 1 cut(s) 531
Asp700I GAANNNNTTC 1 cut(s) 297
AspS9I GGNCC 2 cut(s) 562, 653
AsuHPI GGTGA 1 cut(s) 155
AvaII GGWCC 2 cut(s) 562, 653
BbsI GAAGAC 3 cut(s) 300, 317, 341
Bbv12I GWGCWC 1 cut(s) 225
BbvI GCAGC 2 cut(s) 30, 534
BccI CCATC 4 cut(s) 91, 134, 140, 403
BciT130I CCWGG 2 cut(s) 314, 428
BcoDI GTCTC 1 cut(s) 136
BfaI CTAG 2 cut(s) 38, 417
BfmI CTRYAG 1 cut(s) 123
BisI GCNGC 2 cut(s) 19, 548
BlpI GCTNAGC 1 cut(s) 626
BlsI GCNGC 2 cut(s) 20, 549
Bme1390I CCNGG 2 cut(s) 314, 428
Bme18I GGWCC 2 cut(s) 562, 653
BmgT120I GGNCC 2 cut(s) 562, 653
BmrFI CCNGG 2 cut(s) 314, 428
BmsI GCATC 2 cut(s) 90, 108
BpiI GAAGAC 3 cut(s) 300, 317, 341
Bpu10I CCTNAGC 1 cut(s) 167
Bpu1102I GCTNAGC 1 cut(s) 626
Bse1I ACTGG 1 cut(s) 417
BseBI CCWGG 2 cut(s) 314, 428
BseGI GGATG 1 cut(s) 145
BseMII CTCAG 3 cut(s) 181, 204, 640
BseNI ACTGG 1 cut(s) 417
BseXI GCAGC 2 cut(s) 30, 534
BshFI GGCC 1 cut(s) 617
BsiHKAI GWGCWC 1 cut(s) 225
BsmAI GTCTC 1 cut(s) 136
BsnI GGCC 1 cut(s) 617
Bsp1286I GDGCHC 1 cut(s) 225
Bsp1720I GCTNAGC 1 cut(s) 626
BspANI GGCC 1 cut(s) 617
BspCNI CTCAG 3 cut(s) 180, 203, 639
BspMAI CTGCAG 1 cut(s) 127
BsrI ACTGG 1 cut(s) 417
Bst2UI CCWGG 2 cut(s) 314, 428
Bst4CI ACNGT 3 cut(s) 227, 332, 518
Bst6I CTCTTC 1 cut(s) 405
BstAPI GCANNNNNTGC 1 cut(s) 62
BstC8I GCNNGC 2 cut(s) 123, 164
BstDEI CTNAG 4 cut(s) 167, 190, 626, 649
BstF5I GGATG 1 cut(s) 145
BstMAI GTCTC 1 cut(s) 136
BstMWI GCNNNNNNNGC 3 cut(s) 62, 122, 574
BstNI CCWGG 2 cut(s) 314, 428
BstSCI CCNGG 2 cut(s) 312, 426
BstSFI CTRYAG 1 cut(s) 123
BstV1I GCAGC 2 cut(s) 30, 534
BstV2I GAAGAC 3 cut(s) 300, 317, 341
BsuRI GGCC 1 cut(s) 617
BtgZI GCGATG 1 cut(s) 131
BtsCI GGATG 1 cut(s) 145
BtsIMutI CAGTG 2 cut(s) 328, 410
Cac8I GCNNGC 2 cut(s) 123, 164
Cfr13I GGNCC 2 cut(s) 562, 653
CviAII CATG 2 cut(s) 448, 485
DdeI CTNAG 4 cut(s) 167, 190, 626, 649
DraIII CACNNNGTG 1 cut(s) 246
DrdI GACNNNNNNGTC 1 cut(s) 560
DseDI GACNNNNNNGTC 1 cut(s) 560
Eam1104I CTCTTC 1 cut(s) 405
EarI CTCTTC 1 cut(s) 405
Eco32I GATATC 1 cut(s) 255
Eco47I GGWCC 2 cut(s) 562, 653
EcoRII CCWGG 2 cut(s) 312, 426
EcoRV GATATC 1 cut(s) 255
FaeI CATG 2 cut(s) 451, 488
FaiI YATR 3 cut(s) 212, 449, 486
FatI CATG 2 cut(s) 447, 484
Fnu4HI GCNGC 2 cut(s) 19, 548
FokI GGATG 1 cut(s) 152
Fsp4HI GCNGC 2 cut(s) 19, 548
FspBI CTAG 2 cut(s) 38, 417
GluI GCNGC 2 cut(s) 19, 548
HaeIII GGCC 1 cut(s) 617
Hin1II CATG 2 cut(s) 451, 488
HincII GTYRAC 1 cut(s) 490
HindII GTYRAC 1 cut(s) 490
HinfI GANTC 3 cut(s) 41, 322, 491
HphI GGTGA 1 cut(s) 155
Hpy166II GTNNAC 2 cut(s) 467, 490
Hpy188I TCNGA 3 cut(s) 358, 528, 589
Hpy188III TCNNGA 4 cut(s) 29, 319, 539, 640
Hpy8I GTNNAC 2 cut(s) 467, 490
HpyAV CCTTC 3 cut(s) 193, 615, 646
HpyCH4III ACNGT 3 cut(s) 227, 332, 518
HpyCH4IV ACGT 2 cut(s) 234, 297
HpyCH4V TGCA 7 cut(s) 18, 65, 81, 125, 249, 308, 521
HpyF10VI GCNNNNNNNGC 3 cut(s) 62, 122, 574
HpyF3I CTNAG 4 cut(s) 167, 190, 626, 649
HpySE526I ACGT 2 cut(s) 234, 297
Hsp92II CATG 2 cut(s) 451, 488
LmnI GCTCC 1 cut(s) 220
Lsp1109I GCAGC 2 cut(s) 30, 534
LweI GCATC 2 cut(s) 90, 108
MaeI CTAG 2 cut(s) 38, 417
MaeII ACGT 2 cut(s) 234, 297
MaeIII GTNAC 2 cut(s) 238, 422
MboII GAAGA 6 cut(s) 178, 302, 305, 317, 341, 392
MhlI GDGCHC 1 cut(s) 225
MluCI AATT 9 cut(s) 7, 46, 75, 173, 372, 377, 389, 451, 522
MlyI GAGTC 2 cut(s) 331, 485
MnlI CCTC 4 cut(s) 84, 94, 454, 628
MroXI GAANNNNTTC 1 cut(s) 297
MseI TTAA 3 cut(s) 204, 216, 531
MspR9I CCNGG 2 cut(s) 314, 428
MvaI CCWGG 2 cut(s) 314, 428
MwoI GCNNNNNNNGC 3 cut(s) 62, 122, 574
NlaIII CATG 2 cut(s) 451, 488
NmuCI GTSAC 1 cut(s) 238
PdmI GAANNNNTTC 1 cut(s) 297
PfeI GAWTC 1 cut(s) 41
PkrI GCNGC 2 cut(s) 20, 549
PleI GAGTC 2 cut(s) 330, 485
PpsI GAGTC 2 cut(s) 330, 485
PshBI ATTAAT 1 cut(s) 531
Psp6I CCWGG 2 cut(s) 312, 426
PspGI CCWGG 2 cut(s) 312, 426
PspPI GGNCC 2 cut(s) 562, 653
PstI CTGCAG 1 cut(s) 127
SaqAI TTAA 3 cut(s) 204, 216, 531
SatI GCNGC 2 cut(s) 19, 548
Sau96I GGNCC 2 cut(s) 562, 653
SchI GAGTC 2 cut(s) 331, 485
ScrFI CCNGG 2 cut(s) 314, 428
SduI GDGCHC 1 cut(s) 225
SetI ASST 9 cut(s) 39, 95, 164, 237, 300, 318, 476, 549, 647
SfaNI GCATC 2 cut(s) 90, 108
SfcI CTRYAG 1 cut(s) 123
SinI GGWCC 2 cut(s) 562, 653
Sse9I AATT 9 cut(s) 7, 46, 75, 173, 372, 377, 389, 451, 522
SspI AATATT 2 cut(s) 70, 664
SspMI CTAG 2 cut(s) 38, 417
StyD4I CCNGG 2 cut(s) 312, 426
TaaI ACNGT 3 cut(s) 227, 332, 518
TaiI ACGT 2 cut(s) 237, 300
TaqI TCGA 1 cut(s) 318
TasI AATT 9 cut(s) 7, 46, 75, 173, 372, 377, 389, 451, 522
TfiI GAWTC 1 cut(s) 41
Tru1I TTAA 3 cut(s) 204, 216, 531
Tru9I TTAA 3 cut(s) 204, 216, 531
TscAI CASTG 2 cut(s) 335, 417
TseFI GTSAC 1 cut(s) 238
TseI GCWGC 2 cut(s) 18, 547
Tsp45I GTSAC 1 cut(s) 238
TspDTI ATGAA 2 cut(s) 464, 468
TspRI CASTG 2 cut(s) 335, 417
VpaK11BI GGWCC 2 cut(s) 562, 653
VspI ATTAAT 1 cut(s) 531
XapI RAATTY 1 cut(s) 389
XmnI GAANNNNTTC 1 cut(s) 297
XspI CTAG 2 cut(s) 38, 417
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.