Rroxscaffold_4G00298700

BP28CT (NUC211) domain

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Reverse (-)
18508360 .. 18509326
967 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00298700.1

Sequence Viewer

Length: 231 bp
ATGAATTGTATTGAGGTTTACAGACCTTTTCATCTCATGTTTGACACTTCGAGCAAGAAAAATGGAAACCATGCAATTTGGATTAATCATCTTGATAAGCTACTGGACTTGGTGGTCCAGCAGAAAAGGCTAATCCTATTGGACAAGAACTTGCTTCCTTCTCTCTTGGCCTCTTTTCTCAGCCCGTCCTTCCAGAGCTTCTTAGGACCAAAGAATATTGAGATAAGGTGA

Protein Analysis

76

Amino Acids

8.82

Weight (kDa)

9.36

Isoelectric Point (pI)

55.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018531)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 113
AluBI AGCT 2 cut(s) 100, 198
AluI AGCT 2 cut(s) 100, 198
AoxI GGCC 1 cut(s) 168
AseI ATTAAT 1 cut(s) 84
AspS9I GGNCC 2 cut(s) 115, 206
AvaII GGWCC 2 cut(s) 115, 206
Bme18I GGWCC 2 cut(s) 115, 206
BmgT120I GGNCC 2 cut(s) 115, 206
Bse1I ACTGG 1 cut(s) 108
BseMII CTCAG 1 cut(s) 193
BseNI ACTGG 1 cut(s) 108
BshFI GGCC 1 cut(s) 170
BsnI GGCC 1 cut(s) 170
BspANI GGCC 1 cut(s) 170
BspCNI CTCAG 1 cut(s) 192
BsrI ACTGG 1 cut(s) 108
BstDEI CTNAG 2 cut(s) 179, 202
BstMWI GCNNNNNNNGC 1 cut(s) 127
BsuRI GGCC 1 cut(s) 170
Cfr13I GGNCC 2 cut(s) 115, 206
CviAII CATG 2 cut(s) 37, 71
CviJI RGCY 5 cut(s) 100, 130, 170, 183, 198
CviKI_1 RGCY 5 cut(s) 100, 130, 170, 183, 198
DdeI CTNAG 2 cut(s) 179, 202
DrdI GACNNNNNNGTC 1 cut(s) 113
DseDI GACNNNNNNGTC 1 cut(s) 113
Eco47I GGWCC 2 cut(s) 115, 206
FaeI CATG 2 cut(s) 40, 74
FaiI YATR 2 cut(s) 38, 72
FatI CATG 2 cut(s) 36, 70
HaeIII GGCC 1 cut(s) 170
Hin1II CATG 2 cut(s) 40, 74
Hpy166II GTNNAC 1 cut(s) 19
Hpy188III TCNNGA 2 cut(s) 92, 193
Hpy8I GTNNAC 1 cut(s) 19
HpyAV CCTTC 2 cut(s) 168, 199
HpyCH4V TGCA 1 cut(s) 74
HpyF10VI GCNNNNNNNGC 1 cut(s) 127
HpyF3I CTNAG 2 cut(s) 179, 202
Hsp92II CATG 2 cut(s) 40, 74
LpnPI CCDG 3 cut(s) 89, 131, 206
MluCI AATT 2 cut(s) 4, 75
MnlI CCTC 2 cut(s) 7, 181
MseI TTAA 1 cut(s) 84
MwoI GCNNNNNNNGC 1 cut(s) 127
NlaIII CATG 2 cut(s) 40, 74
PshBI ATTAAT 1 cut(s) 84
PspPI GGNCC 2 cut(s) 115, 206
SaqAI TTAA 1 cut(s) 84
Sau96I GGNCC 2 cut(s) 115, 206
SetI ASST 5 cut(s) 18, 28, 102, 200, 230
SinI GGWCC 2 cut(s) 115, 206
Sse9I AATT 2 cut(s) 4, 75
SspI AATATT 1 cut(s) 217
TaqI TCGA 1 cut(s) 50
TasI AATT 2 cut(s) 4, 75
Tru1I TTAA 1 cut(s) 84
Tru9I TTAA 1 cut(s) 84
TspDTI ATGAA 2 cut(s) 17, 20
VpaK11BI GGWCC 2 cut(s) 115, 206
VspI ATTAAT 1 cut(s) 84
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.