Rh1AG091400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Reverse (-)
15895320 .. 15909992
14673 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG091400.1

Sequence Viewer

Length: 153 bp
ATGCTGGAGAACAAGAGGATGATGGACAGCTCTACTAAAGAAATAGAGGACAAGCCTTCTAAGGGCAAGAGAAGAAAAGGCTTTGAGGTTAAGAAAAGTGTTGAGCAAGGGCAGATGATTCTTCAAACTCTCAAGCGAGCAATTGGTGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

50

Amino Acids

5.77

Weight (kDa)

10.09

Isoelectric Point (pI)

76.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018531)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 62
AgsI TTSAA 1 cut(s) 125
AluBI AGCT 1 cut(s) 30
AluI AGCT 1 cut(s) 30
BccI CCATC 1 cut(s) 16
BpmI CTGGAG 1 cut(s) 26
BpuEI CTTGAG 1 cut(s) 116
Bsc4I CCNNNNNNNGG 1 cut(s) 62
BseGI GGATG 1 cut(s) 24
BseLI CCNNNNNNNGG 1 cut(s) 62
BslI CCNNNNNNNGG 1 cut(s) 62
BstC8I GCNNGC 1 cut(s) 138
BstDEI CTNAG 1 cut(s) 60
BstF5I GGATG 1 cut(s) 24
BtsCI GGATG 1 cut(s) 24
Cac8I GCNNGC 1 cut(s) 138
CviJI RGCY 3 cut(s) 30, 55, 81
CviKI_1 RGCY 3 cut(s) 30, 55, 81
DdeI CTNAG 1 cut(s) 60
FokI GGATG 1 cut(s) 31
GsuI CTGGAG 1 cut(s) 26
HinfI GANTC 1 cut(s) 118
HpyAV CCTTC 1 cut(s) 66
HpyF3I CTNAG 1 cut(s) 60
MboII GAAGA 2 cut(s) 84, 113
MfeI CAATTG 1 cut(s) 141
MluCI AATT 1 cut(s) 141
MnlI CCTC 3 cut(s) 9, 40, 79
MseI TTAA 1 cut(s) 90
MunI CAATTG 1 cut(s) 141
PfeI GAWTC 1 cut(s) 118
SaqAI TTAA 1 cut(s) 90
SetI ASST 2 cut(s) 32, 90
SgeI CNNG 7 cut(s) 17, 25, 64, 79, 119, 145, 149
SmlI CTYRAG 1 cut(s) 131
SmoI CTYRAG 1 cut(s) 131
Sse9I AATT 1 cut(s) 141
TasI AATT 1 cut(s) 141
TfiI GAWTC 1 cut(s) 118
Tru1I TTAA 1 cut(s) 90
Tru9I TTAA 1 cut(s) 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.