Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0041710.1

Orthogroup ID

OG0009718

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 897

Gene Structure 897 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0041710.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 798 bp

agtgtttcaaaaacatgcaggttcttctttccagttgcaaacaagaatcacttggcttctgcaattagcaaatataaacccagcgtgatcaacagtgaagacatcaggttctcaagttctactgatcaaagtaagggaagggaaaaccagtcagtctctgatgatttaaaactgaatcctgtctgctgctctgatgaaaaagacactataccccttgaactttgtttgcctgatgaggacagcttaattacagtggatgatttcaggattgtgtcctacaaggatatgcttgagcgaaatgaaatcaaagctgatagggtaatgccaaatgcaccagtcgatagttctaggaagccgatggacacgaaaattggaatcaaagatgaaaaatctactcatgtctacaaaagtgaagttccagtttatcaggggaagtcttcttaccgtgcttcaccagctcttataaattctcaagtgaaagccgttaatccaaagttcaagcctcagaatacatccaaccgagctttctctacaaatgtgcttcctaccactttccatcagtcccaagccaaaccacatcagcaactgcagcagacactctttacagaaacggttccaactccttacatgccggatctgtaccatgcccaagcttttccctggaactaccagatgtcaagttatggatgtgtgccagtgccaactccagggtttcagccctatggcgggactaatcttcttggaactcagagcaatgcactgaatgcagggacaggctattaccttggttggcaatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

265

Amino Acids

29.62

Weight (kDa)

8.17

Isoelectric Point (pI)

41.97

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009718)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_7g30290 FvH4_7g30290 FvH4_7g30341
malus_domestica	MD01G1208800.v1.1
prunus_persica	Prupe.2G301400_v2.0.a1 Prupe.2G301400_v2.0.a1 Prupe.2G301400_v2.0.a1 Prupe.2G301400_v2.0.a1 Prupe.2G301400_v2.0.a1
rosa_chinensis	RchiOBHm_Chr1g0378421
rosa_laevigata	RLG00000026430 RLG00000026437
rosa_multiflora	Rmu_sc0000938.1_g000003 Rmu_sc0040188.1_g000001 Rmu_sc0041710.1_g000001
rosa_roxburghii	Rroxscaffold_4G00280470
rosa_rugosa	Rorug01G0408600
rosa_samantha	Rh1AG430100 Rh1BG387800 Rh1CG401300 Rh1DG418900
rosa_wichuraiana	Rw1G037640

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	464
Acc36I	ACCTGC	1 cut(s)	9
AccI	GTMKAC	1 cut(s)	402
AciI	CCGC	1 cut(s)	726
AclWI	GGATC	1 cut(s)	642
AcsI	RAATTY	1 cut(s)	466
AfaI	GTAC	1 cut(s)	641
AfiI	CCNNNNNNNGG	3 cut(s)	707, 725, 726
AgsI	TTSAA	3 cut(s)	9, 218, 499
AjnI	CCWGG	2 cut(s)	659, 706
AjuI	GAANNNNNNNTTGG	2 cut(s)	509, 541
AluBI	AGCT	5 cut(s)	243, 311, 458, 524, 653
AluI	AGCT	5 cut(s)	243, 311, 458, 524, 653
Alw26I	GTCTC	1 cut(s)	160
AlwI	GGATC	1 cut(s)	642
AlwNI	CAGNNNCTG	2 cut(s)	158, 586
ApeKI	GCWGC	2 cut(s)	186, 589
ApoI	RAATTY	1 cut(s)	466
Asp700I	GAANNNNTTC	1 cut(s)	612
AsuHPI	GGTGA	1 cut(s)	444
BarI	GAAGNNNNNNTAC	2 cut(s)	425, 457
BbsI	GAAGAC	2 cut(s)	105, 429
BbvI	GCAGC	2 cut(s)	173, 601
BccI	CCATC	2 cut(s)	352, 564
BceAI	ACGGC	1 cut(s)	467
BciT130I	CCWGG	2 cut(s)	661, 708
BclI	TGATCA	2 cut(s)	87, 124
BcoDI	GTCTC	1 cut(s)	160
BfaI	CTAG	1 cut(s)	348
BfmI	CTRYAG	1 cut(s)	587
BfuAI	ACCTGC	1 cut(s)	9
BisI	GCNGC	2 cut(s)	187, 590
BlsI	GCNGC	2 cut(s)	188, 591
Bme1390I	CCNGG	2 cut(s)	661, 708
BmiI	GGNNCC	1 cut(s)	615
BmrFI	CCNGG	2 cut(s)	661, 708
BpiI	GAAGAC	2 cut(s)	105, 429
BpmI	CTGGAG	1 cut(s)	690
BpuEI	CTTGAG	3 cut(s)	97, 311, 456
BsaJI	CCNNGG	3 cut(s)	659, 707, 784
Bsc4I	CCNNNNNNNGG	3 cut(s)	707, 725, 726
Bse1I	ACTGG	5 cut(s)	32, 148, 335, 419, 695
Bse3DI	GCAATG	1 cut(s)	760
BseBI	CCWGG	2 cut(s)	661, 708
BseDI	CCNNGG	3 cut(s)	659, 707, 784
BseGI	GGATG	3 cut(s)	262, 512, 692
BseLI	CCNNNNNNNGG	3 cut(s)	707, 725, 726
BseMI	GCAATG	1 cut(s)	760
BseMII	CTCAG	2 cut(s)	518, 761
BseNI	ACTGG	5 cut(s)	32, 148, 335, 419, 695
BseXI	GCAGC	2 cut(s)	173, 601
BseYI	CCCAGC	1 cut(s)	80
BsiSI	CCGG	1 cut(s)	632
BslFI	GGGAC	3 cut(s)	547, 742, 784
BslI	CCNNNNNNNGG	3 cut(s)	707, 725, 726
BsmAI	GTCTC	1 cut(s)	160
BsmFI	GGGAC	3 cut(s)	547, 742, 784
BsmI	GAATGC	1 cut(s)	769
Bsp143I	GATC	3 cut(s)	87, 124, 634
BspACI	CCGC	1 cut(s)	726
BspCNI	CTCAG	2 cut(s)	517, 760
BspLI	GGNNCC	1 cut(s)	615
BspMAI	CTGCAG	1 cut(s)	591
BspMI	ACCTGC	1 cut(s)	9
BspPI	GGATC	1 cut(s)	642
BsrDI	GCAATG	1 cut(s)	760
BsrI	ACTGG	5 cut(s)	32, 148, 335, 419, 695
BssECI	CCNNGG	3 cut(s)	659, 707, 784
BssMI	GATC	3 cut(s)	87, 124, 634
BssT1I	CCWWGG	1 cut(s)	784
Bst2UI	CCWGG	2 cut(s)	661, 708
Bst4CI	ACNGT	4 cut(s)	95, 253, 446, 613
BstAPI	GCANNNNNTGC	1 cut(s)	764
BstDEI	CTNAG	2 cut(s)	504, 747
BstF5I	GGATG	3 cut(s)	262, 512, 692
BstKTI	GATC	3 cut(s)	90, 127, 637
BstMAI	GTCTC	1 cut(s)	160
BstMBI	GATC	3 cut(s)	87, 124, 634
BstMWI	GCNNNNNNNGC	3 cut(s)	455, 589, 764
BstNI	CCWGG	2 cut(s)	661, 708
BstNSI	RCATGY	2 cut(s)	18, 631
BstSCI	CCNGG	2 cut(s)	659, 706
BstSFI	CTRYAG	1 cut(s)	587
BstV1I	GCAGC	2 cut(s)	173, 601
BstV2I	GAAGAC	2 cut(s)	105, 429
BstX2I	RGATCY	1 cut(s)	634
BstYI	RGATCY	1 cut(s)	634
BtsCI	GGATG	3 cut(s)	262, 512, 692
BtsIMutI	CAGTG	4 cut(s)	100, 258, 702, 758
BveI	ACCTGC	1 cut(s)	9
CaiI	CAGNNNCTG	2 cut(s)	158, 586
Csp6I	GTAC	1 cut(s)	640
CviAII	CATG	4 cut(s)	15, 398, 628, 644
CviQI	GTAC	1 cut(s)	640
DdeI	CTNAG	2 cut(s)	504, 747
DpnI	GATC	3 cut(s)	89, 126, 636
DpnII	GATC	3 cut(s)	87, 124, 634
DraI	TTTAAA	1 cut(s)	168
Eco130I	CCWWGG	1 cut(s)	784
EcoRII	CCWGG	2 cut(s)	659, 706
EcoT14I	CCWWGG	1 cut(s)	784
ErhI	CCWWGG	1 cut(s)	784
FaeI	CATG	4 cut(s)	18, 401, 631, 647
FalI	AAGNNNNNCTT	2 cut(s)	35, 67
FaqI	GGGAC	3 cut(s)	547, 742, 784
FatI	CATG	4 cut(s)	14, 397, 627, 643
FauI	CCCGC	1 cut(s)	719
FbaI	TGATCA	2 cut(s)	87, 124
FblI	GTMKAC	1 cut(s)	402
Fnu4HI	GCNGC	2 cut(s)	187, 590
FokI	GGATG	3 cut(s)	269, 499, 699
Fsp4HI	GCNGC	2 cut(s)	187, 590
FspBI	CTAG	1 cut(s)	348
GluI	GCNGC	2 cut(s)	187, 590
GsaI	CCCAGC	1 cut(s)	84
GsuI	CTGGAG	1 cut(s)	690
HapII	CCGG	1 cut(s)	632
Hin1II	CATG	4 cut(s)	18, 401, 631, 647
HindIII	AAGCTT	1 cut(s)	651
HinfI	GANTC	3 cut(s)	46, 175, 375
HpaII	CCGG	1 cut(s)	632
HphI	GGTGA	1 cut(s)	444
Hpy166II	GTNNAC	1 cut(s)	403
Hpy188I	TCNGA	4 cut(s)	160, 193, 507, 750
Hpy188III	TCNNGA	1 cut(s)	265
Hpy8I	GTNNAC	1 cut(s)	403
HpyAV	CCTTC	1 cut(s)	132
HpyCH4III	ACNGT	4 cut(s)	95, 253, 446, 613
HpyCH4V	TGCA	7 cut(s)	18, 38, 62, 332, 589, 758, 767
HpyF10VI	GCNNNNNNNGC	3 cut(s)	455, 589, 764
HpyF3I	CTNAG	2 cut(s)	504, 747
Hsp92II	CATG	4 cut(s)	18, 401, 631, 647
Ksp22I	TGATCA	2 cut(s)	87, 124
Kzo9I	GATC	3 cut(s)	87, 124, 634
Lsp1109I	GCAGC	2 cut(s)	173, 601
MaeI	CTAG	1 cut(s)	348
MalI	GATC	3 cut(s)	89, 126, 636
MboI	GATC	3 cut(s)	87, 124, 634
MboII	GAAGA	4 cut(s)	16, 110, 429, 728
MflI	RGATCY	1 cut(s)	634
MluCI	AATT	4 cut(s)	63, 246, 369, 466
MmeI	TCCRAC	2 cut(s)	540, 641
MnlI	CCTC	2 cut(s)	229, 513
MroXI	GAANNNNTTC	1 cut(s)	612
MseI	TTAA	3 cut(s)	167, 245, 486
MspI	CCGG	1 cut(s)	632
MspR9I	CCNGG	2 cut(s)	661, 708
Mva1269I	GAATGC	1 cut(s)	769
MvaI	CCWGG	2 cut(s)	661, 708
MwoI	GCNNNNNNNGC	3 cut(s)	455, 589, 764
NdeII	GATC	3 cut(s)	87, 124, 634
NlaIII	CATG	4 cut(s)	18, 401, 631, 647
NlaIV	GGNNCC	1 cut(s)	615
NspI	RCATGY	2 cut(s)	18, 631
PctI	GAATGC	1 cut(s)	769
PdmI	GAANNNNTTC	1 cut(s)	612
PfeI	GAWTC	3 cut(s)	46, 175, 375
PkrI	GCNGC	2 cut(s)	188, 591
PsiI	TTATAA	1 cut(s)	464
Psp6I	CCWGG	2 cut(s)	659, 706
PspFI	CCCAGC	1 cut(s)	80
PspGI	CCWGG	2 cut(s)	659, 706
PspN4I	GGNNCC	1 cut(s)	615
PstI	CTGCAG	1 cut(s)	591
PstNI	CAGNNNCTG	2 cut(s)	158, 586
PsuI	RGATCY	1 cut(s)	634
RsaI	GTAC	1 cut(s)	641
RsaNI	GTAC	1 cut(s)	640
SaqAI	TTAA	3 cut(s)	167, 245, 486
SatI	GCNGC	2 cut(s)	187, 590
Sau3AI	GATC	3 cut(s)	87, 124, 634
ScrFI	CCNGG	2 cut(s)	661, 708
SetI	ASST	8 cut(s)	23, 110, 245, 313, 460, 526, 655, 786
SfcI	CTRYAG	1 cut(s)	587
SmlI	CTYRAG	3 cut(s)	112, 290, 471
SmoI	CTYRAG	3 cut(s)	112, 290, 471
Sse9I	AATT	4 cut(s)	63, 246, 369, 466
SsiI	CCGC	1 cut(s)	726
SspMI	CTAG	1 cut(s)	348
StyD4I	CCNGG	2 cut(s)	659, 706
StyI	CCWWGG	1 cut(s)	784
TaaI	ACNGT	4 cut(s)	95, 253, 446, 613
TaqI	TCGA	1 cut(s)	339
TasI	AATT	4 cut(s)	63, 246, 369, 466
TfiI	GAWTC	3 cut(s)	46, 175, 375
Tru1I	TTAA	3 cut(s)	167, 245, 486
Tru9I	TTAA	3 cut(s)	167, 245, 486
TscAI	CASTG	4 cut(s)	100, 258, 702, 765
TseI	GCWGC	2 cut(s)	186, 589
TspDTI	ATGAA	3 cut(s)	210, 315, 399
TspRI	CASTG	4 cut(s)	100, 258, 702, 765
XapI	RAATTY	1 cut(s)	466
XceI	RCATGY	2 cut(s)	18, 631
XmiI	GTMKAC	1 cut(s)	402
XmnI	GAANNNNTTC	1 cut(s)	612
XspI	CTAG	1 cut(s)	348

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.