Rmu_sc0041970.1_g000001

TMV resistance protein N-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0041970.1
OG0020059
Physical Location & Seq
Reverse (-)
156 .. 560
405 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0041970.1_g000001.1.cds

Sequence Viewer

Length: 405 bp
atgactcctcggatgaacctgtttagatgccctgcactgtaccacaatctggctcttgacgtggcaggggtgaaaaagaatttaccggatgagtccaggttaacggctctgttgtctctcttcttctcatttcggccatccgagtatcatgtcttgtttcctggaagtattagggcctacgaacggctactcgggatagtggaatctagttggagattgaccgaaattggacttccggagtggttcacctgcctcacgtatatcgataagaaaggacttcaagtatggaactttagaattgattttcctcgaaatttcaaatgggagggcaaaggattggctttctgtgctctagaggcttttttttacgggagtatatttcagaatactcagaatctatattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NB-ARC TIR

Protein Analysis

134

Amino Acids

15.69

Weight (kDa)

8.84

Isoelectric Point (pI)

30.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020059)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0003177.1_g000027 Rmu_sc0007121.1_g000030 Rmu_sc0041970.1_g000001 Rmu_ssc0000432.1_g000121
rosa_roxburghii Rroxscaffold_1G00002560
rosa_samantha Rh5BG548300 Rh5BG549500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 257
Acc36I ACCTGC 1 cut(s) 257
AccB7I CCANNNNNTGG 1 cut(s) 49
AccIII TCCGGA 1 cut(s) 235
AcoI YGGCCR 1 cut(s) 134
AcsI RAATTY 2 cut(s) 79, 313
AfaI GTAC 1 cut(s) 41
AfiI CCNNNNNNNGG 2 cut(s) 49, 183
AgsI TTSAA 2 cut(s) 281, 319
AjiI CACGTC 1 cut(s) 61
AjnI CCWGG 2 cut(s) 95, 160
Alw21I GWGCWC 1 cut(s) 352
Alw26I GTCTC 1 cut(s) 120
Ama87I CYCGRG 1 cut(s) 191
Aor13HI TCCGGA 1 cut(s) 235
AoxI GGCC 2 cut(s) 134, 174
ApoI RAATTY 2 cut(s) 79, 313
AspS9I GGNCC 1 cut(s) 174
AsuHPI GGTGA 2 cut(s) 82, 238
AvaI CYCGRG 1 cut(s) 191
Bbv12I GWGCWC 1 cut(s) 352
BccI CCATC 1 cut(s) 145
BceAI ACGGC 2 cut(s) 120, 200
BciT130I CCWGG 2 cut(s) 97, 162
BcoDI GTCTC 1 cut(s) 120
BfaI CTAG 2 cut(s) 207, 353
BfuAI ACCTGC 1 cut(s) 257
Bme1390I CCNGG 2 cut(s) 97, 162
BmeT110I CYCGRG 1 cut(s) 191
BmgBI CACGTC 1 cut(s) 61
BmgT120I GGNCC 1 cut(s) 174
BmrFI CCNGG 2 cut(s) 97, 162
BmsI GCATC 1 cut(s) 17
Bsa29I ATCGAT 1 cut(s) 264
BsaAI YACGTR 1 cut(s) 258
BsaJI CCNNGG 1 cut(s) 8
BsaWI WCCGGW 2 cut(s) 85, 235
Bsc4I CCNNNNNNNGG 2 cut(s) 49, 183
BseAI TCCGGA 1 cut(s) 235
BseBI CCWGG 2 cut(s) 97, 162
BseCI ATCGAT 1 cut(s) 264
BseDI CCNNGG 1 cut(s) 8
BseGI GGATG 3 cut(s) 18, 94, 137
BseLI CCNNNNNNNGG 2 cut(s) 49, 183
BseMII CTCAG 1 cut(s) 404
BsgI GTGCAG 1 cut(s) 18
BshFI GGCC 2 cut(s) 136, 176
BshVI ATCGAT 1 cut(s) 264
BsiHKAI GWGCWC 1 cut(s) 352
BsiHKCI CYCGRG 1 cut(s) 191
BsiSI CCGG 2 cut(s) 86, 236
BslI CCNNNNNNNGG 2 cut(s) 49, 183
BsmAI GTCTC 1 cut(s) 120
BsnI GGCC 2 cut(s) 136, 176
BsoBI CYCGRG 1 cut(s) 191
Bsp1286I GDGCHC 1 cut(s) 352
Bsp13I TCCGGA 1 cut(s) 235
BspANI GGCC 2 cut(s) 136, 176
BspCNI CTCAG 1 cut(s) 403
BspDI ATCGAT 1 cut(s) 264
BspEI TCCGGA 1 cut(s) 235
BspMI ACCTGC 1 cut(s) 257
BssECI CCNNGG 1 cut(s) 8
Bst2UI CCWGG 2 cut(s) 97, 162
Bst4CI ACNGT 1 cut(s) 39
Bst6I CTCTTC 1 cut(s) 125
BstBAI YACGTR 1 cut(s) 258
BstDEI CTNAG 1 cut(s) 390
BstF5I GGATG 3 cut(s) 18, 94, 137
BstMAI GTCTC 1 cut(s) 120
BstMWI GCNNNNNNNGC 2 cut(s) 347, 356
BstNI CCWGG 2 cut(s) 97, 162
BstSCI CCNGG 2 cut(s) 95, 160
Bsu15I ATCGAT 1 cut(s) 264
BsuRI GGCC 2 cut(s) 136, 176
BsuTUI ATCGAT 1 cut(s) 264
BtrI CACGTC 1 cut(s) 61
BtsCI GGATG 3 cut(s) 18, 94, 137
BtsIMutI CAGTG 1 cut(s) 35
BveI ACCTGC 1 cut(s) 257
Cfr13I GGNCC 1 cut(s) 174
ClaI ATCGAT 1 cut(s) 264
Csp6I GTAC 1 cut(s) 40
CviAII CATG 1 cut(s) 149
CviJI RGCY 7 cut(s) 53, 107, 136, 176, 187, 341, 359
CviKI_1 RGCY 7 cut(s) 53, 107, 136, 176, 187, 341, 359
CviQI GTAC 1 cut(s) 40
DdeI CTNAG 1 cut(s) 390
EaeI YGGCCR 1 cut(s) 134
Eam1104I CTCTTC 1 cut(s) 125
EarI CTCTTC 1 cut(s) 125
Eco88I CYCGRG 1 cut(s) 191
EcoO109I RGGNCCY 1 cut(s) 174
EcoRII CCWGG 2 cut(s) 95, 160
FaeI CATG 1 cut(s) 152
FaiI YATR 5 cut(s) 150, 261, 286, 377, 400
FatI CATG 1 cut(s) 148
FokI GGATG 3 cut(s) 25, 101, 124
FspBI CTAG 2 cut(s) 207, 353
HaeIII GGCC 2 cut(s) 136, 176
HapII CCGG 2 cut(s) 86, 236
Hin1II CATG 1 cut(s) 152
HincII GTYRAC 1 cut(s) 102
HindII GTYRAC 1 cut(s) 102
HinfI GANTC 4 cut(s) 4, 92, 203, 394
HpaI GTTAAC 1 cut(s) 102
HpaII CCGG 2 cut(s) 86, 236
HphI GGTGA 2 cut(s) 82, 238
Hpy166II GTNNAC 2 cut(s) 102, 246
Hpy188I TCNGA 4 cut(s) 12, 142, 384, 393
Hpy188III TCNNGA 4 cut(s) 56, 193, 236, 353
Hpy8I GTNNAC 2 cut(s) 102, 246
HpyCH4III ACNGT 1 cut(s) 39
HpyCH4IV ACGT 2 cut(s) 60, 257
HpyCH4V TGCA 1 cut(s) 35
HpyF10VI GCNNNNNNNGC 2 cut(s) 347, 356
HpyF3I CTNAG 1 cut(s) 390
HpySE526I ACGT 2 cut(s) 60, 257
Hsp92II CATG 1 cut(s) 152
Kpn2I TCCGGA 1 cut(s) 235
KspAI GTTAAC 1 cut(s) 102
LweI GCATC 1 cut(s) 17
MaeI CTAG 2 cut(s) 207, 353
MaeII ACGT 2 cut(s) 60, 257
MboII GAAGA 2 cut(s) 112, 115
MhlI GDGCHC 1 cut(s) 352
MluCI AATT 4 cut(s) 79, 225, 297, 313
MlyI GAGTC 1 cut(s) 101
MmeI TCCRAC 1 cut(s) 191
MnlI CCTC 5 cut(s) 18, 263, 318, 319, 349
MroI TCCGGA 1 cut(s) 235
MseI TTAA 2 cut(s) 101, 403
MspI CCGG 2 cut(s) 86, 236
MspR9I CCNGG 2 cut(s) 97, 162
MvaI CCWGG 2 cut(s) 97, 162
MwoI GCNNNNNNNGC 2 cut(s) 347, 356
NlaIII CATG 1 cut(s) 152
PaqCI CACCTGC 1 cut(s) 257
PfeI GAWTC 2 cut(s) 203, 394
PflMI CCANNNNNTGG 1 cut(s) 49
PfoI TCCNGGA 1 cut(s) 160
PleI GAGTC 1 cut(s) 100
PpsI GAGTC 1 cut(s) 100
Ppu21I YACGTR 1 cut(s) 258
Psp6I CCWGG 2 cut(s) 95, 160
PspGI CCWGG 2 cut(s) 95, 160
PspPI GGNCC 1 cut(s) 174
RsaI GTAC 1 cut(s) 41
RsaNI GTAC 1 cut(s) 40
SaqAI TTAA 2 cut(s) 101, 403
Sau96I GGNCC 1 cut(s) 174
SchI GAGTC 1 cut(s) 101
ScrFI CCNGG 2 cut(s) 97, 162
SduI GDGCHC 1 cut(s) 352
SetI ASST 5 cut(s) 21, 63, 101, 251, 260
SfaNI GCATC 1 cut(s) 17
Sse9I AATT 4 cut(s) 79, 225, 297, 313
SspMI CTAG 2 cut(s) 207, 353
StyD4I CCNGG 2 cut(s) 95, 160
TaaI ACNGT 1 cut(s) 39
TaiI ACGT 2 cut(s) 63, 260
TaqI TCGA 2 cut(s) 264, 310
TaqII GACCGA 1 cut(s) 236
TasI AATT 4 cut(s) 79, 225, 297, 313
TfiI GAWTC 2 cut(s) 203, 394
Tru1I TTAA 2 cut(s) 101, 403
Tru9I TTAA 2 cut(s) 101, 403
TscAI CASTG 1 cut(s) 42
TspDTI ATGAA 1 cut(s) 29
TspRI CASTG 1 cut(s) 42
Van91I CCANNNNNTGG 1 cut(s) 49
XapI RAATTY 2 cut(s) 79, 313
XbaI TCTAGA 1 cut(s) 352
XspI CTAG 2 cut(s) 207, 353
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.