Rh5BG548300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Reverse (-)
87083189 .. 87088755
5567 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG548300.1

Sequence Viewer

Length: 216 bp
ATGAAGCTTGATGGTCATGATATATATGGCTCAAGACAGGAAATTGTTTCTTCTAGAGCTCTGCATTTGGTTAGTGAATTGGCCGGCATTGACAGTGGACCTCTTTTGTATTCTCAGGAGAAATTTGTATCTCTGAGCATATTGAAGGGAGGTTTTCTACGTCAGATGACTAGGATCTACACATCACCATTGGGGAAGAGACTACAGGTAATTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

71

Amino Acids

7.92

Weight (kDa)

9.6

Isoelectric Point (pI)

51.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020059)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 182
AcoI YGGCCR 1 cut(s) 81
AcsI RAATTY 1 cut(s) 122
AgsI TTSAA 1 cut(s) 145
AluBI AGCT 2 cut(s) 7, 59
AluI AGCT 2 cut(s) 7, 59
Alw21I GWGCWC 1 cut(s) 61
Alw26I GTCTC 1 cut(s) 193
AlwI GGATC 1 cut(s) 182
AoxI GGCC 1 cut(s) 81
ApoI RAATTY 1 cut(s) 122
AspS9I GGNCC 1 cut(s) 98
AsuHPI GGTGA 1 cut(s) 177
AvaII GGWCC 1 cut(s) 98
BanII GRGCYC 1 cut(s) 61
Bbv12I GWGCWC 1 cut(s) 61
BccI CCATC 1 cut(s) 5
BcoDI GTCTC 1 cut(s) 193
BfaI CTAG 2 cut(s) 54, 171
BfmI CTRYAG 1 cut(s) 203
Bme18I GGWCC 1 cut(s) 98
BmgT120I GGNCC 1 cut(s) 98
BpuEI CTTGAG 1 cut(s) 16
Bse118I RCCGGY 1 cut(s) 83
BseMII CTCAG 2 cut(s) 125, 128
BshFI GGCC 1 cut(s) 83
BsiHKAI GWGCWC 1 cut(s) 61
BsiSI CCGG 1 cut(s) 84
BsmAI GTCTC 1 cut(s) 193
BsnI GGCC 1 cut(s) 83
Bsp1286I GDGCHC 1 cut(s) 61
Bsp143I GATC 1 cut(s) 174
BspANI GGCC 1 cut(s) 83
BspCNI CTCAG 2 cut(s) 126, 127
BspHI TCATGA 1 cut(s) 16
BspPI GGATC 1 cut(s) 182
BsrFI RCCGGY 1 cut(s) 83
BssAI RCCGGY 1 cut(s) 83
BssMI GATC 1 cut(s) 174
Bst4CI ACNGT 1 cut(s) 95
Bst6I CTCTTC 1 cut(s) 191
BstC8I GCNNGC 1 cut(s) 85
BstDEI CTNAG 2 cut(s) 114, 134
BstKTI GATC 1 cut(s) 177
BstMAI GTCTC 1 cut(s) 193
BstMBI GATC 1 cut(s) 174
BstSFI CTRYAG 1 cut(s) 203
BstX2I RGATCY 1 cut(s) 174
BstYI RGATCY 1 cut(s) 174
BsuRI GGCC 1 cut(s) 83
BtsIMutI CAGTG 1 cut(s) 100
Cac8I GCNNGC 1 cut(s) 85
CciI TCATGA 1 cut(s) 16
Cfr10I RCCGGY 1 cut(s) 83
Cfr13I GGNCC 1 cut(s) 98
CviAII CATG 1 cut(s) 17
CviJI RGCY 4 cut(s) 7, 30, 59, 83
CviKI_1 RGCY 4 cut(s) 7, 30, 59, 83
DdeI CTNAG 2 cut(s) 114, 134
DpnI GATC 1 cut(s) 176
DpnII GATC 1 cut(s) 174
EaeI YGGCCR 1 cut(s) 81
Eam1104I CTCTTC 1 cut(s) 191
EarI CTCTTC 1 cut(s) 191
Ecl136II GAGCTC 1 cut(s) 59
Eco24I GRGCYC 1 cut(s) 61
Eco47I GGWCC 1 cut(s) 98
Eco53kI GAGCTC 1 cut(s) 59
EcoICRI GAGCTC 1 cut(s) 59
EcoT38I GRGCYC 1 cut(s) 61
FaeI CATG 1 cut(s) 20
FaiI YATR 5 cut(s) 18, 23, 25, 27, 140
FatI CATG 1 cut(s) 16
FriOI GRGCYC 1 cut(s) 61
FspBI CTAG 2 cut(s) 54, 171
HaeIII GGCC 1 cut(s) 83
HapII CCGG 1 cut(s) 84
Hin1II CATG 1 cut(s) 20
HindIII AAGCTT 1 cut(s) 5
HpaII CCGG 1 cut(s) 84
HphI GGTGA 1 cut(s) 177
Hpy166II GTNNAC 1 cut(s) 98
Hpy188I TCNGA 2 cut(s) 135, 165
Hpy188III TCNNGA 4 cut(s) 17, 33, 54, 116
Hpy8I GTNNAC 1 cut(s) 98
HpyAV CCTTC 1 cut(s) 139
HpyCH4III ACNGT 1 cut(s) 95
HpyCH4IV ACGT 1 cut(s) 160
HpyCH4V TGCA 1 cut(s) 64
HpyF3I CTNAG 2 cut(s) 114, 134
HpySE526I ACGT 1 cut(s) 160
Hsp92II CATG 1 cut(s) 20
KroI GCCGGC 1 cut(s) 83
KroNI GCCGGC 1 cut(s) 85
Kzo9I GATC 1 cut(s) 174
LpnPI CCDG 4 cut(s) 23, 97, 101, 191
MaeI CTAG 2 cut(s) 54, 171
MaeII ACGT 1 cut(s) 160
MalI GATC 1 cut(s) 176
MboI GATC 1 cut(s) 174
MboII GAAGA 2 cut(s) 42, 208
MflI RGATCY 1 cut(s) 174
MhlI GDGCHC 1 cut(s) 61
MluCI AATT 4 cut(s) 42, 77, 122, 210
MnlI CCTC 2 cut(s) 111, 143
MroNI GCCGGC 1 cut(s) 83
MseI TTAA 1 cut(s) 214
MspI CCGG 1 cut(s) 84
NaeI GCCGGC 1 cut(s) 85
NdeII GATC 1 cut(s) 174
NgoMIV GCCGGC 1 cut(s) 83
NlaIII CATG 1 cut(s) 20
PagI TCATGA 1 cut(s) 16
PdiI GCCGGC 1 cut(s) 85
Psp124BI GAGCTC 1 cut(s) 61
PspPI GGNCC 1 cut(s) 98
PsuI RGATCY 1 cut(s) 174
SacI GAGCTC 1 cut(s) 61
SaqAI TTAA 1 cut(s) 214
Sau3AI GATC 1 cut(s) 174
Sau96I GGNCC 1 cut(s) 98
SduI GDGCHC 1 cut(s) 61
SetI ASST 6 cut(s) 9, 61, 103, 154, 163, 210
SfcI CTRYAG 1 cut(s) 203
SgeI CNNG 8 cut(s) 20, 29, 45, 50, 66, 96, 128, 183
SinI GGWCC 1 cut(s) 98
SmlI CTYRAG 1 cut(s) 31
SmoI CTYRAG 1 cut(s) 31
Sse9I AATT 4 cut(s) 42, 77, 122, 210
SspMI CTAG 2 cut(s) 54, 171
SstI GAGCTC 1 cut(s) 61
TaaI ACNGT 1 cut(s) 95
TaiI ACGT 1 cut(s) 163
TasI AATT 4 cut(s) 42, 77, 122, 210
Tru1I TTAA 1 cut(s) 214
Tru9I TTAA 1 cut(s) 214
TscAI CASTG 1 cut(s) 100
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 100
VpaK11BI GGWCC 1 cut(s) 98
XapI RAATTY 1 cut(s) 122
XbaI TCTAGA 1 cut(s) 53
XspI CTAG 2 cut(s) 54, 171
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.