Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000047.1

Orthogroup ID

OG0013767

Physical Location & Seq

Genomic Coordinates Reverse (-)

49617 .. 49901

Gene Structure 285 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000047.1_g000008.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 285 bp

atggttggttttaatgtgctgttcttcctggactttgtgagcccaacaaagtttgacaacaactacttcaagatcttattggctaacaagggtctgcttaactctgaccaagttcttgttacaaagagtgaagtagccaagcatttggttcaacaacatgcagtgaacaacgagcttttcctcgagcaatttgccaagtccatgattaagatggggaatctttcaccaattacaggttcaaggggagagatcagaaagaattgcaggaaggtcaactactcttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0003006 GO:0003674 GO:0003824 GO:0004601 GO:0005575 GO:0005618 GO:0005623 GO:0005975 GO:0005976 GO:0006725 GO:0007275 GO:0008150 GO:0008152 GO:0009056 GO:0009058 GO:0009505 GO:0009636 GO:0009698 GO:0009699 GO:0009791 GO:0009808 GO:0009809 GO:0009845 GO:0009987 GO:0010154 GO:0010383 GO:0016209 GO:0016491 GO:0016684 GO:0016998 GO:0019438 GO:0019748 GO:0022414 GO:0030312 GO:0032501 GO:0032502 GO:0032504 GO:0042221 GO:0043170 GO:0044036 GO:0044237 GO:0044238 GO:0044248 GO:0044249 GO:0044260 GO:0044347 GO:0044464 GO:0044550 GO:0048316 GO:0048608 GO:0048609 GO:0048731 GO:0048856 GO:0050896 GO:0051716 GO:0055114 GO:0061458 GO:0070887 GO:0071554 GO:0071704 GO:0071944 GO:0080001 GO:0090351 GO:0097237 GO:0098754 GO:0098869 GO:1901360 GO:1901362 GO:1901576 GO:1990748

KEGG Pathways

Metabolic & Signaling

ko00940 ko01100 ko01110 map00940 map01100 map01110

Pfam Domains

Protein Families

peroxidase

Protein Analysis

94

Amino Acids

10.7

Weight (kDa)

9.61

Isoelectric Point (pI)

25.59

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013767)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr5g0024911 RchiOBHm_Chr7g0212091 RchiOBHm_Chr7g0234291
rosa_laevigata	RLG00000003091 RLG00000034444
rosa_multiflora	Rmu_sc0002775.1_g000016 Rmu_sc0021904.1_g000008 Rmu_ssc0000047.1_g000008
rosa_roxburghii	Rroxscaffold_2G00142410 Rroxscaffold_3G00245830
rosa_samantha	Rh5CG191800 Rh5DG176100 Rh7AG415000 Rh7AG439700 Rh7CG075700 Rh7DG143600 Rh7DG429400
rosa_wichuraiana	Rw1G011430

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AfiI	CCNNNNNNNGG	1 cut(s)	233
AgsI	TTSAA	3 cut(s)	70, 152, 240
AjnI	CCWGG	1 cut(s)	27
AjuI	GAANNNNNNNTTGG	2 cut(s)	220, 252
AluBI	AGCT	1 cut(s)	175
AluI	AGCT	1 cut(s)	175
Ama87I	CYCGRG	1 cut(s)	182
AsuHPI	GGTGA	1 cut(s)	216
AvaI	CYCGRG	1 cut(s)	182
BanII	GRGCYC	1 cut(s)	44
BarI	GAAGNNNNNNTAC	1 cut(s)	260
BccI	CCATC	1 cut(s)	205
BcgI	CGANNNNNNTGC	2 cut(s)	173, 207
BciT130I	CCWGG	1 cut(s)	29
BglII	AGATCT	1 cut(s)	72
Bme1390I	CCNGG	1 cut(s)	29
BmeT110I	CYCGRG	1 cut(s)	182
BmrFI	CCNGG	1 cut(s)	29
Bsc4I	CCNNNNNNNGG	1 cut(s)	233
BseBI	CCWGG	1 cut(s)	29
BseLI	CCNNNNNNNGG	1 cut(s)	233
BsiHKCI	CYCGRG	1 cut(s)	182
BslI	CCNNNNNNNGG	1 cut(s)	233
BsoBI	CYCGRG	1 cut(s)	182
Bsp1286I	GDGCHC	1 cut(s)	44
Bsp143I	GATC	2 cut(s)	72, 249
BssMI	GATC	2 cut(s)	72, 249
Bst2UI	CCWGG	1 cut(s)	29
BstKTI	GATC	2 cut(s)	75, 252
BstMBI	GATC	2 cut(s)	72, 249
BstNI	CCWGG	1 cut(s)	29
BstNSI	RCATGY	1 cut(s)	161
BstSCI	CCNGG	1 cut(s)	27
BstX2I	RGATCY	1 cut(s)	72
BstXI	CCANNNNNNTGG	1 cut(s)	145
BstYI	RGATCY	1 cut(s)	72
BtsI	GCAGTG	1 cut(s)	168
BtsIMutI	CAGTG	1 cut(s)	168
CviAII	CATG	2 cut(s)	158, 202
CviJI	RGCY	4 cut(s)	42, 83, 137, 175
CviKI_1	RGCY	4 cut(s)	42, 83, 137, 175
DpnI	GATC	2 cut(s)	74, 251
DpnII	GATC	2 cut(s)	72, 249
Eco24I	GRGCYC	1 cut(s)	44
Eco88I	CYCGRG	1 cut(s)	182
EcoRII	CCWGG	1 cut(s)	27
EcoT38I	GRGCYC	1 cut(s)	44
FaeI	CATG	2 cut(s)	161, 205
FaiI	YATR	2 cut(s)	159, 203
FatI	CATG	2 cut(s)	157, 201
FriOI	GRGCYC	1 cut(s)	44
Hin1II	CATG	2 cut(s)	161, 205
HincII	GTYRAC	1 cut(s)	274
HindII	GTYRAC	1 cut(s)	274
HinfI	GANTC	1 cut(s)	217
HphI	GGTGA	1 cut(s)	216
Hpy166II	GTNNAC	2 cut(s)	166, 274
Hpy188I	TCNGA	2 cut(s)	106, 254
Hpy188III	TCNNGA	2 cut(s)	70, 282
Hpy8I	GTNNAC	2 cut(s)	166, 274
HpyAV	CCTTC	1 cut(s)	262
HpyCH4V	TGCA	2 cut(s)	161, 264
Hsp92II	CATG	2 cut(s)	161, 205
Kzo9I	GATC	2 cut(s)	72, 249
LpnPI	CCDG	4 cut(s)	14, 41, 219, 250
MaeIII	GTNAC	1 cut(s)	118
MalI	GATC	2 cut(s)	74, 251
MboI	GATC	2 cut(s)	72, 249
MboII	GAAGA	1 cut(s)	16
MflI	RGATCY	1 cut(s)	72
MhlI	GDGCHC	1 cut(s)	44
MluCI	AATT	3 cut(s)	188, 228, 259
MnlI	CCTC	1 cut(s)	191
MseI	TTAA	3 cut(s)	12, 99, 207
MspR9I	CCNGG	1 cut(s)	29
MvaI	CCWGG	1 cut(s)	29
NdeII	GATC	2 cut(s)	72, 249
NlaIII	CATG	2 cut(s)	161, 205
NspI	RCATGY	1 cut(s)	161
PaeR7I	CTCGAG	1 cut(s)	182
PfeI	GAWTC	1 cut(s)	217
PfoI	TCCNGGA	1 cut(s)	27
Psp6I	CCWGG	1 cut(s)	27
PspGI	CCWGG	1 cut(s)	27
PspXI	VCTCGAGB	1 cut(s)	182
PsuI	RGATCY	1 cut(s)	72
SaqAI	TTAA	3 cut(s)	12, 99, 207
Sau3AI	GATC	2 cut(s)	72, 249
ScrFI	CCNGG	1 cut(s)	29
SduI	GDGCHC	1 cut(s)	44
SetI	ASST	3 cut(s)	177, 238, 273
Sfr274I	CTCGAG	1 cut(s)	182
SlaI	CTCGAG	1 cut(s)	182
SmlI	CTYRAG	1 cut(s)	182
SmoI	CTYRAG	1 cut(s)	182
Sse9I	AATT	3 cut(s)	188, 228, 259
StyD4I	CCNGG	1 cut(s)	27
TaqI	TCGA	1 cut(s)	183
TasI	AATT	3 cut(s)	188, 228, 259
TfiI	GAWTC	1 cut(s)	217
Tru1I	TTAA	3 cut(s)	12, 99, 207
Tru9I	TTAA	3 cut(s)	12, 99, 207
TscAI	CASTG	1 cut(s)	168
TspRI	CASTG	1 cut(s)	168
XceI	RCATGY	1 cut(s)	161
XcmI	CCANNNNNNNNNTGG	1 cut(s)	208
XhoI	CTCGAG	1 cut(s)	182

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.