Rmu_ssc0000089.1_g000012

protein At2g27730, mitochondrial-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000089.1
OG0014960
Physical Location & Seq
Forward (+)
98488 .. 99943
1456 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000089.1_g000012.1.cds

Sequence Viewer

Length: 255 bp
atgagatctgttcagagccgagtggtgctgactcgagccttgttgactcgctctatggagtgctctcggggagccacccgttactacagtgacggaaagggcaagattctcagcgaggaggaacgcgctgctgagaacgtctacatcaagaaaatggagagggagaggctggagaagctgaagcagaaggctgccaaagaaagcgccgagaatgagaaagtaattgctgataagaagactgacggaacccattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
IATP

Protein Analysis

84

Amino Acids

9.63

Weight (kDa)

9.63

Isoelectric Point (pI)

42.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014960)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G04750 AT5G04750
fragaria_vesca FvH4_7g05151
malus_domestica MD07G1070900.v1.1
pyrus_communis pycom07g05410
rosa_chinensis RchiOBHm_Chr1g0331731
rosa_multiflora Rmu_ssc0000089.1_g000012
rosa_roxburghii Rroxscaffold_4G00283330 Rroxscaffold_4G00318830
rosa_rugosa Rorug01G0095900
rosa_samantha Rh1AG119700 Rh1BG091300 Rh1CG114800 Rh1DG125200
rosa_wichuraiana Rw1G009680 Rw3G014220

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 141
AccII CGCG 1 cut(s) 126
AcuI CTGAAG 1 cut(s) 200
AluBI AGCT 1 cut(s) 178
AluI AGCT 1 cut(s) 178
Alw21I GWGCWC 1 cut(s) 65
Ama87I CYCGRG 2 cut(s) 33, 66
ApeKI GCWGC 2 cut(s) 128, 191
AspLEI GCGC 2 cut(s) 128, 206
AvaI CYCGRG 2 cut(s) 33, 66
BbsI GAAGAC 1 cut(s) 242
Bbv12I GWGCWC 1 cut(s) 65
BbvI GCAGC 2 cut(s) 115, 178
BfmI CTRYAG 1 cut(s) 85
BfoI RGCGCY 1 cut(s) 207
BglII AGATCT 1 cut(s) 5
BisI GCNGC 2 cut(s) 129, 192
BlsI GCNGC 2 cut(s) 130, 193
BmeT110I CYCGRG 2 cut(s) 33, 66
BmiI GGNNCC 2 cut(s) 73, 247
BpiI GAAGAC 1 cut(s) 242
BpmI CTGGAG 1 cut(s) 191
BseMII CTCAG 2 cut(s) 123, 124
BseRI GAGGAG 1 cut(s) 131
BseXI GCAGC 2 cut(s) 115, 178
Bsh1236I CGCG 1 cut(s) 126
BsiHKAI GWGCWC 1 cut(s) 65
BsiHKCI CYCGRG 2 cut(s) 33, 66
BsoBI CYCGRG 2 cut(s) 33, 66
Bsp1286I GDGCHC 1 cut(s) 65
Bsp143I GATC 1 cut(s) 5
BspCNI CTCAG 2 cut(s) 123, 124
BspFNI CGCG 1 cut(s) 126
BspLI GGNNCC 2 cut(s) 73, 247
BssMI GATC 1 cut(s) 5
Bst4CI ACNGT 1 cut(s) 89
BstDEI CTNAG 2 cut(s) 110, 132
BstFNI CGCG 1 cut(s) 126
BstH2I RGCGCY 1 cut(s) 207
BstHHI GCGC 2 cut(s) 128, 206
BstKTI GATC 1 cut(s) 8
BstMBI GATC 1 cut(s) 5
BstMWI GCNNNNNNNGC 1 cut(s) 175
BstSFI CTRYAG 1 cut(s) 85
BstUI CGCG 1 cut(s) 126
BstV1I GCAGC 2 cut(s) 115, 178
BstV2I GAAGAC 1 cut(s) 242
BstX2I RGATCY 1 cut(s) 5
BstYI RGATCY 1 cut(s) 5
BtsIMutI CAGTG 1 cut(s) 94
CfoI GCGC 2 cut(s) 128, 206
CviJI RGCY 6 cut(s) 18, 38, 74, 169, 178, 191
CviKI_1 RGCY 6 cut(s) 18, 38, 74, 169, 178, 191
DdeI CTNAG 2 cut(s) 110, 132
DpnI GATC 1 cut(s) 7
DpnII GATC 1 cut(s) 5
Eco57I CTGAAG 1 cut(s) 200
Eco88I CYCGRG 2 cut(s) 33, 66
FaiI YATR 1 cut(s) 56
FblI GTMKAC 1 cut(s) 141
Fnu4HI GCNGC 2 cut(s) 129, 192
Fsp4HI GCNGC 2 cut(s) 129, 192
GlaI GCGC 2 cut(s) 127, 205
GluI GCNGC 2 cut(s) 129, 192
GsuI CTGGAG 1 cut(s) 191
HaeII RGCGCY 1 cut(s) 207
HhaI GCGC 2 cut(s) 128, 206
Hin6I GCGC 2 cut(s) 126, 204
HinP1I GCGC 2 cut(s) 126, 204
HincII GTYRAC 1 cut(s) 45
HindII GTYRAC 1 cut(s) 45
HinfI GANTC 3 cut(s) 31, 46, 106
Hpy166II GTNNAC 2 cut(s) 45, 142
Hpy188I TCNGA 1 cut(s) 15
Hpy188III TCNNGA 1 cut(s) 148
Hpy8I GTNNAC 2 cut(s) 45, 142
HpyAV CCTTC 1 cut(s) 181
HpyCH4III ACNGT 1 cut(s) 89
HpyCH4IV ACGT 1 cut(s) 138
HpyF10VI GCNNNNNNNGC 1 cut(s) 175
HpyF3I CTNAG 2 cut(s) 110, 132
HpySE526I ACGT 1 cut(s) 138
HspAI GCGC 2 cut(s) 126, 204
Kzo9I GATC 1 cut(s) 5
LmnI GCTCC 1 cut(s) 71
LpnPI CCDG 1 cut(s) 155
Lsp1109I GCAGC 2 cut(s) 115, 178
MaeII ACGT 1 cut(s) 138
MaeIII GTNAC 2 cut(s) 80, 89
MalI GATC 1 cut(s) 7
MboI GATC 1 cut(s) 5
MboII GAAGA 1 cut(s) 247
MflI RGATCY 1 cut(s) 5
MhlI GDGCHC 1 cut(s) 65
MluCI AATT 1 cut(s) 222
MlyI GAGTC 2 cut(s) 25, 40
MnlI CCTC 4 cut(s) 109, 112, 153, 159
MseI TTAA 1 cut(s) 253
MvnI CGCG 1 cut(s) 126
MwoI GCNNNNNNNGC 1 cut(s) 175
NdeII GATC 1 cut(s) 5
NlaIV GGNNCC 2 cut(s) 73, 247
NmeAIII GCCGAG 2 cut(s) 44, 232
NmuCI GTSAC 1 cut(s) 89
PaeR7I CTCGAG 1 cut(s) 33
PfeI GAWTC 1 cut(s) 106
PkrI GCNGC 2 cut(s) 130, 193
PleI GAGTC 2 cut(s) 25, 40
PpsI GAGTC 2 cut(s) 25, 40
PspN4I GGNNCC 2 cut(s) 73, 247
PspXI VCTCGAGB 1 cut(s) 33
PsuI RGATCY 1 cut(s) 5
SaqAI TTAA 1 cut(s) 253
SatI GCNGC 2 cut(s) 129, 192
Sau3AI GATC 1 cut(s) 5
SchI GAGTC 2 cut(s) 25, 40
SduI GDGCHC 1 cut(s) 65
SetI ASST 2 cut(s) 141, 180
SfcI CTRYAG 1 cut(s) 85
Sfr274I CTCGAG 1 cut(s) 33
SlaI CTCGAG 1 cut(s) 33
SmlI CTYRAG 1 cut(s) 33
SmoI CTYRAG 1 cut(s) 33
Sse9I AATT 1 cut(s) 222
TaaI ACNGT 1 cut(s) 89
TaiI ACGT 1 cut(s) 141
TaqI TCGA 1 cut(s) 34
TasI AATT 1 cut(s) 222
TfiI GAWTC 1 cut(s) 106
Tru1I TTAA 1 cut(s) 253
Tru9I TTAA 1 cut(s) 253
TscAI CASTG 1 cut(s) 94
TseFI GTSAC 1 cut(s) 89
TseI GCWGC 2 cut(s) 128, 191
Tsp45I GTSAC 1 cut(s) 89
TspGWI ACGGA 1 cut(s) 108
TspRI CASTG 1 cut(s) 94
XhoI CTCGAG 1 cut(s) 33
XmiI GTMKAC 1 cut(s) 141
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.