Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000114.1

Orthogroup ID

OG0009199

Physical Location & Seq

Genomic Coordinates Forward (+)

105203 .. 105704

Gene Structure 502 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000114.1_g000015.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 252 bp

atggctcttccccttgatttgcaggacttccttctccgcgctcgagtcttgaagctgtataggcaagcactgagggttactcgaagagcccctcttgaggctagaggtgaactaagaacaacgattagacaagaaatggagaatagccgagactgcaatgacaggcagaagattcgttatttgcttagcgaaggattagagaggttaaaacgtctagatgagatgcttgacatgcaaggccatcctgattaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Complex1_LYR

Protein Analysis

83

Amino Acids

9.94

Weight (kDa)

9.5

Isoelectric Point (pI)

40.0

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009199)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G76065
fragaria_vesca	FvH4_2g37960 FvH4_2g37960 FvH4_2g37960 FvH4_2g37960 FvH4_2g37960
malus_domestica	MD08G1007600.v1.1 MD15G1006800.v1.1
prunus_persica	Prupe.1G359500_v2.0.a1 Prupe.1G359500_v2.0.a1
pyrus_communis	pycom08g00630 pycom15g00540
rosa_chinensis	RchiOBHm_Chr6g0303661
rosa_multiflora	Rmu_sc0013443.1_g000005 Rmu_ssc0000114.1_g000015
rosa_rugosa	Rorug06G0323500 Rorug06G0323600
rosa_samantha	Rh6AG437800 Rh6BG465300 Rh6CG449900 Rh6DG436700
rosa_wichuraiana	Rw6G037900

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	1 cut(s)	39
AciI	CCGC	1 cut(s)	37
AfiI	CCNNNNNNNGG	1 cut(s)	97
AgsI	TTSAA	1 cut(s)	52
AluBI	AGCT	1 cut(s)	55
AluI	AGCT	1 cut(s)	55
Alw26I	GTCTC	1 cut(s)	144
Ama87I	CYCGRG	1 cut(s)	42
AoxI	GGCC	1 cut(s)	238
AspLEI	GCGC	1 cut(s)	41
AsuHPI	GGTGA	1 cut(s)	119
AvaI	CYCGRG	1 cut(s)	42
BanII	GRGCYC	1 cut(s)	91
BccI	CCATC	1 cut(s)	249
BcgI	CGANNNNNNTGC	2 cut(s)	155, 189
BcoDI	GTCTC	1 cut(s)	144
BfaI	CTAG	2 cut(s)	102, 215
BlpI	GCTNAGC	1 cut(s)	185
BmeT110I	CYCGRG	1 cut(s)	42
BmsI	GCATC	1 cut(s)	213
BplI	GAGNNNNNCTC	2 cut(s)	64, 96
Bpu1102I	GCTNAGC	1 cut(s)	185
BpuEI	CTTGAG	1 cut(s)	116
Bsc4I	CCNNNNNNNGG	1 cut(s)	97
Bse3DI	GCAATG	1 cut(s)	163
BseGI	GGATG	1 cut(s)	241
BseLI	CCNNNNNNNGG	1 cut(s)	97
BseMI	GCAATG	1 cut(s)	163
BseMII	CTCAG	1 cut(s)	62
Bsh1236I	CGCG	1 cut(s)	39
BshFI	GGCC	1 cut(s)	240
BsiHKCI	CYCGRG	1 cut(s)	42
BslI	CCNNNNNNNGG	1 cut(s)	97
BsmAI	GTCTC	1 cut(s)	144
BsnI	GGCC	1 cut(s)	240
BsoBI	CYCGRG	1 cut(s)	42
Bsp1286I	GDGCHC	1 cut(s)	91
Bsp1720I	GCTNAGC	1 cut(s)	185
BspACI	CCGC	1 cut(s)	37
BspANI	GGCC	1 cut(s)	240
BspCNI	CTCAG	1 cut(s)	63
BspFNI	CGCG	1 cut(s)	39
BspQI	GCTCTTC	2 cut(s)	12, 79
BsrDI	GCAATG	1 cut(s)	163
Bst6I	CTCTTC	2 cut(s)	12, 79
BstC8I	GCNNGC	1 cut(s)	66
BstDEI	CTNAG	3 cut(s)	71, 113, 185
BstF5I	GGATG	1 cut(s)	241
BstFNI	CGCG	1 cut(s)	39
BstHHI	GCGC	1 cut(s)	41
BstMAI	GTCTC	1 cut(s)	144
BstMWI	GCNNNNNNNGC	3 cut(s)	61, 153, 232
BstNSI	RCATGY	1 cut(s)	235
BstUI	CGCG	1 cut(s)	39
BsuRI	GGCC	1 cut(s)	240
BtsCI	GGATG	1 cut(s)	241
BtsIMutI	CAGTG	1 cut(s)	68
Cac8I	GCNNGC	1 cut(s)	66
CfoI	GCGC	1 cut(s)	41
CviAII	CATG	1 cut(s)	232
CviJI	RGCY	6 cut(s)	5, 55, 89, 101, 147, 240
CviKI_1	RGCY	6 cut(s)	5, 55, 89, 101, 147, 240
DdeI	CTNAG	3 cut(s)	71, 113, 185
Eam1104I	CTCTTC	2 cut(s)	12, 79
EarI	CTCTTC	2 cut(s)	12, 79
Eco24I	GRGCYC	1 cut(s)	91
Eco88I	CYCGRG	1 cut(s)	42
EcoT38I	GRGCYC	1 cut(s)	91
FaeI	CATG	1 cut(s)	235
FaiI	YATR	2 cut(s)	60, 233
FatI	CATG	1 cut(s)	231
FokI	GGATG	1 cut(s)	228
FriOI	GRGCYC	1 cut(s)	91
FspBI	CTAG	2 cut(s)	102, 215
GlaI	GCGC	1 cut(s)	40
HaeIII	GGCC	1 cut(s)	240
HhaI	GCGC	1 cut(s)	41
Hin1II	CATG	1 cut(s)	235
Hin6I	GCGC	1 cut(s)	39
HinP1I	GCGC	1 cut(s)	39
HinfI	GANTC	2 cut(s)	45, 172
HphI	GGTGA	1 cut(s)	119
Hpy166II	GTNNAC	1 cut(s)	110
Hpy188III	TCNNGA	4 cut(s)	49, 95, 215, 245
Hpy8I	GTNNAC	1 cut(s)	110
HpyAV	CCTTC	2 cut(s)	41, 185
HpyCH4IV	ACGT	1 cut(s)	211
HpyCH4V	TGCA	3 cut(s)	22, 156, 235
HpyF10VI	GCNNNNNNNGC	3 cut(s)	61, 153, 232
HpyF3I	CTNAG	3 cut(s)	71, 113, 185
HpySE526I	ACGT	1 cut(s)	211
Hsp92II	CATG	1 cut(s)	235
HspAI	GCGC	1 cut(s)	39
LguI	GCTCTTC	2 cut(s)	12, 79
LpnPI	CCDG	2 cut(s)	8, 148
LweI	GCATC	1 cut(s)	213
MaeI	CTAG	2 cut(s)	102, 215
MaeII	ACGT	1 cut(s)	211
MaeIII	GTNAC	1 cut(s)	76
MboII	GAAGA	2 cut(s)	96, 181
MhlI	GDGCHC	1 cut(s)	91
MlyI	GAGTC	1 cut(s)	54
MnlI	CCTC	5 cut(s)	66, 91, 98, 102, 195
MseI	TTAA	2 cut(s)	206, 250
MvnI	CGCG	1 cut(s)	39
MwoI	GCNNNNNNNGC	3 cut(s)	61, 153, 232
NlaIII	CATG	1 cut(s)	235
NmeAIII	GCCGAG	1 cut(s)	173
NspI	RCATGY	1 cut(s)	235
PaeR7I	CTCGAG	1 cut(s)	42
PciSI	GCTCTTC	2 cut(s)	12, 79
PfeI	GAWTC	1 cut(s)	172
PleI	GAGTC	1 cut(s)	53
PpsI	GAGTC	1 cut(s)	53
PspXI	VCTCGAGB	1 cut(s)	42
SapI	GCTCTTC	2 cut(s)	12, 79
SaqAI	TTAA	2 cut(s)	206, 250
SchI	GAGTC	1 cut(s)	54
SduI	GDGCHC	1 cut(s)	91
SetI	ASST	4 cut(s)	57, 109, 206, 214
SfaNI	GCATC	1 cut(s)	213
Sfr274I	CTCGAG	1 cut(s)	42
SlaI	CTCGAG	1 cut(s)	42
SmlI	CTYRAG	2 cut(s)	42, 95
SmoI	CTYRAG	2 cut(s)	42, 95
SsiI	CCGC	1 cut(s)	37
SspMI	CTAG	2 cut(s)	102, 215
TaiI	ACGT	1 cut(s)	214
TaqI	TCGA	2 cut(s)	43, 82
TfiI	GAWTC	1 cut(s)	172
Tru1I	TTAA	2 cut(s)	206, 250
Tru9I	TTAA	2 cut(s)	206, 250
TscAI	CASTG	1 cut(s)	75
TspRI	CASTG	1 cut(s)	75
XbaI	TCTAGA	1 cut(s)	214
XceI	RCATGY	1 cut(s)	235
XhoI	CTCGAG	1 cut(s)	42
XspI	CTAG	2 cut(s)	102, 215

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.