Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000158.1

Orthogroup ID

OG0018390

Physical Location & Seq

Genomic Coordinates Reverse (-)

11731 .. 12246

Gene Structure 516 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000158.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 516 bp

atggcagagggtgagggcgatgaccttgtagatgatgttgtagaaataatcatactcaagttgcccttgaaatctacactgaaatttcgatgcgtctcaaaaaaatggagctgtagaatctctgactatagattctcccgaaggcactataaattagcgcgttgccagaaaactgtgaatcacaggctcatcatcatctcctcatctcaaatggaatccttggacctccaggcgaagtcatcatcaattagaaagcttacctgcccattcttggaactcgagcaatggcggtttcttcaagtcaattactgggctctagtagtggtttggtatgtgcaagtttcgatcctcataaaaacttcatcttatggaatccatcaaccactttcttcaggaaattacccgacccagatcttggtggttatttttcagaggaagaagcagaagaagttgagtttagtgtttatcactaccgctttggttgtgtgtcggctactgacgactataaacttttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

F-box

Protein Analysis

171

Amino Acids

19.9

Weight (kDa)

9.79

Isoelectric Point (pI)

34.19

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018390)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g40801
rosa_chinensis	RchiOBHm_Chr6g0299781
rosa_laevigata	RLG00000011388 RLG00000011389
rosa_multiflora	Rmu_ssc0000158.1_g000002 Rmu_ssc0000158.1_g000003
rosa_roxburghii	Rroxscaffold_7G00168380
rosa_rugosa	Rorug06G0292200
rosa_samantha	Rh6CG417800
rosa_wichuraiana	Rw6G035290

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	269
AccB7I	CCANNNNNTGG	1 cut(s)	415
AccII	CGCG	1 cut(s)	160
AciI	CCGC	2 cut(s)	289, 474
AclWI	GGATC	1 cut(s)	340
AcsI	RAATTY	1 cut(s)	83
AcuI	CTGAAG	1 cut(s)	375
AfiI	CCNNNNNNNGG	2 cut(s)	271, 415
AgsI	TTSAA	2 cut(s)	70, 299
AjnI	CCWGG	1 cut(s)	228
AluBI	AGCT	2 cut(s)	111, 256
AluI	AGCT	2 cut(s)	111, 256
Alw26I	GTCTC	1 cut(s)	100
AlwI	GGATC	1 cut(s)	340
Ama87I	CYCGRG	1 cut(s)	278
ApoI	RAATTY	1 cut(s)	83
AspLEI	GCGC	1 cut(s)	160
AspS9I	GGNCC	1 cut(s)	223
AsuHPI	GGTGA	1 cut(s)	23
AvaI	CYCGRG	1 cut(s)	278
AvaII	GGWCC	1 cut(s)	223
BanII	GRGCYC	1 cut(s)	316
BccI	CCATC	1 cut(s)	384
BciT130I	CCWGG	1 cut(s)	230
BcoDI	GTCTC	1 cut(s)	100
BfaI	CTAG	1 cut(s)	317
BfmI	CTRYAG	2 cut(s)	112, 127
BfuAI	ACCTGC	1 cut(s)	269
BglII	AGATCT	1 cut(s)	411
Bme1390I	CCNGG	1 cut(s)	230
Bme18I	GGWCC	1 cut(s)	223
BmeT110I	CYCGRG	1 cut(s)	278
BmgT120I	GGNCC	1 cut(s)	223
BmrFI	CCNGG	1 cut(s)	230
BmrI	ACTGGG	1 cut(s)	319
BmsI	GCATC	1 cut(s)	80
BmuI	ACTGGG	1 cut(s)	319
BpmI	CTGGAG	1 cut(s)	212
BpuEI	CTTGAG	1 cut(s)	41
BsaJI	CCNNGG	1 cut(s)	219
Bsc4I	CCNNNNNNNGG	2 cut(s)	271, 415
Bse1I	ACTGG	1 cut(s)	314
Bse3DI	GCAATG	1 cut(s)	290
BseBI	CCWGG	1 cut(s)	230
BseDI	CCNNGG	1 cut(s)	219
BseLI	CCNNNNNNNGG	2 cut(s)	271, 415
BseMI	GCAATG	1 cut(s)	290
BseNI	ACTGG	1 cut(s)	314
BseRI	GAGGAG	1 cut(s)	190
Bsh1236I	CGCG	1 cut(s)	160
BsiHKCI	CYCGRG	1 cut(s)	278
BslI	CCNNNNNNNGG	2 cut(s)	271, 415
BsmAI	GTCTC	1 cut(s)	100
BsmBI	CGTCTC	1 cut(s)	100
BsoBI	CYCGRG	1 cut(s)	278
Bsp1286I	GDGCHC	1 cut(s)	316
Bsp143I	GATC	2 cut(s)	345, 411
BspACI	CCGC	2 cut(s)	289, 474
BspFNI	CGCG	1 cut(s)	160
BspMI	ACCTGC	1 cut(s)	269
BspPI	GGATC	1 cut(s)	340
BsrDI	GCAATG	1 cut(s)	290
BsrI	ACTGG	1 cut(s)	314
BssECI	CCNNGG	1 cut(s)	219
BssMI	GATC	2 cut(s)	345, 411
BssT1I	CCWWGG	1 cut(s)	219
Bst2UI	CCWGG	1 cut(s)	230
Bst4CI	ACNGT	1 cut(s)	175
BstFNI	CGCG	1 cut(s)	160
BstHHI	GCGC	1 cut(s)	160
BstKTI	GATC	2 cut(s)	348, 414
BstMAI	GTCTC	1 cut(s)	100
BstMBI	GATC	2 cut(s)	345, 411
BstNI	CCWGG	1 cut(s)	230
BstSCI	CCNGG	1 cut(s)	228
BstSFI	CTRYAG	2 cut(s)	112, 127
BstUI	CGCG	1 cut(s)	160
BstX2I	RGATCY	1 cut(s)	411
BstYI	RGATCY	1 cut(s)	411
BtgZI	GCGATG	1 cut(s)	33
BtsIMutI	CAGTG	1 cut(s)	77
BveI	ACCTGC	1 cut(s)	269
CfoI	GCGC	1 cut(s)	160
Cfr13I	GGNCC	1 cut(s)	223
CseI	GACGC	1 cut(s)	82
CviJI	RGCY	5 cut(s)	111, 187, 256, 314, 493
CviKI_1	RGCY	5 cut(s)	111, 187, 256, 314, 493
DpnI	GATC	2 cut(s)	347, 413
DpnII	GATC	2 cut(s)	345, 411
Eco130I	CCWWGG	1 cut(s)	219
Eco24I	GRGCYC	1 cut(s)	316
Eco47I	GGWCC	1 cut(s)	223
Eco57I	CTGAAG	1 cut(s)	375
Eco88I	CYCGRG	1 cut(s)	278
EcoRII	CCWGG	1 cut(s)	228
EcoT14I	CCWWGG	1 cut(s)	219
EcoT38I	GRGCYC	1 cut(s)	316
ErhI	CCWWGG	1 cut(s)	219
Esp3I	CGTCTC	1 cut(s)	100
FaiI	YATR	7 cut(s)	53, 129, 150, 333, 353, 369, 506
FalI	AAGNNNNNCTT	2 cut(s)	50, 82
FriOI	GRGCYC	1 cut(s)	316
FspBI	CTAG	1 cut(s)	317
GlaI	GCGC	1 cut(s)	159
GsuI	CTGGAG	1 cut(s)	212
HgaI	GACGC	1 cut(s)	82
HhaI	GCGC	1 cut(s)	160
Hin6I	GCGC	1 cut(s)	158
HinP1I	GCGC	1 cut(s)	158
HindIII	AAGCTT	1 cut(s)	254
HinfI	GANTC	5 cut(s)	117, 132, 178, 215, 372
HphI	GGTGA	1 cut(s)	23
Hpy188I	TCNGA	2 cut(s)	124, 432
Hpy188III	TCNNGA	2 cut(s)	138, 393
HpyAV	CCTTC	1 cut(s)	135
HpyCH4III	ACNGT	1 cut(s)	175
HpyCH4V	TGCA	1 cut(s)	337
HspAI	GCGC	1 cut(s)	158
Kzo9I	GATC	2 cut(s)	345, 411
LmnI	GCTCC	1 cut(s)	108
LpnPI	CCDG	8 cut(s)	169, 179, 215, 242, 274, 295, 378, 422
LweI	GCATC	1 cut(s)	80
MaeI	CTAG	1 cut(s)	317
MalI	GATC	2 cut(s)	347, 413
MboI	GATC	2 cut(s)	345, 411
MboII	GAAGA	4 cut(s)	287, 381, 448, 457
MflI	RGATCY	1 cut(s)	411
MhlI	GDGCHC	1 cut(s)	316
MluCI	AATT	5 cut(s)	83, 152, 246, 304, 397
MnlI	CCTC	5 cut(s)	7, 211, 236, 359, 426
MspR9I	CCNGG	1 cut(s)	230
MvaI	CCWGG	1 cut(s)	230
MvnI	CGCG	1 cut(s)	160
NdeII	GATC	2 cut(s)	345, 411
PaeR7I	CTCGAG	1 cut(s)	278
PfeI	GAWTC	5 cut(s)	117, 132, 178, 215, 372
PflMI	CCANNNNNTGG	1 cut(s)	415
Psp6I	CCWGG	1 cut(s)	228
PspGI	CCWGG	1 cut(s)	228
PspPI	GGNCC	1 cut(s)	223
PspXI	VCTCGAGB	1 cut(s)	278
PsuI	RGATCY	1 cut(s)	411
Sau3AI	GATC	2 cut(s)	345, 411
Sau96I	GGNCC	1 cut(s)	223
ScrFI	CCNGG	1 cut(s)	230
SduI	GDGCHC	1 cut(s)	316
SetI	ASST	5 cut(s)	27, 113, 228, 258, 263
SfaNI	GCATC	1 cut(s)	80
SfcI	CTRYAG	2 cut(s)	112, 127
Sfr274I	CTCGAG	1 cut(s)	278
SinI	GGWCC	1 cut(s)	223
SlaI	CTCGAG	1 cut(s)	278
SmlI	CTYRAG	2 cut(s)	56, 278
SmoI	CTYRAG	2 cut(s)	56, 278
Sse9I	AATT	5 cut(s)	83, 152, 246, 304, 397
SsiI	CCGC	2 cut(s)	289, 474
SspMI	CTAG	1 cut(s)	317
StyD4I	CCNGG	1 cut(s)	228
StyI	CCWWGG	1 cut(s)	219
TaaI	ACNGT	1 cut(s)	175
TaqI	TCGA	3 cut(s)	88, 279, 344
TasI	AATT	5 cut(s)	83, 152, 246, 304, 397
TfiI	GAWTC	5 cut(s)	117, 132, 178, 215, 372
TscAI	CASTG	1 cut(s)	84
TspDTI	ATGAA	1 cut(s)	351
TspRI	CASTG	1 cut(s)	84
Van91I	CCANNNNNTGG	1 cut(s)	415
VpaK11BI	GGWCC	1 cut(s)	223
XapI	RAATTY	1 cut(s)	83
XhoI	CTCGAG	1 cut(s)	278
XspI	CTAG	1 cut(s)	317

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.