Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000273.1

Orthogroup ID

OG0011006

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 1966

Gene Structure 1966 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000273.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 919 bp

ggaacttgtacagtcagggaaagacattgaaactgcatattgggaacttgtggtgaaggacattcaagacgcttgcaagctttttgagtcaatctatgatcaaactgatgctgctgatggctatgtttctgttgaagtttctcccagacttgctgatgacactgaagggactgtagaggctgcaaaatggttacataaagttgtttcccgacccaatgtctacataaagattcccgctactgctccatgcatcccttctattaaggaagttatagcaaatggcatcagtgtcaatgtgactcttatattctctctcactagatatgaggcagtcattgatgcgtatttggatggccttgaggcttctggcctagacgacctctccagagtaacaagtgttgcttctttctttgtcagtagggttgacacccttattgacaagttgcttgaaaagattggaactccagaggctcttgaccttcgaggaaaggctgcagtagctcaagccgctttagcgtaccaactataccagaagaaattctcaggtcccagatgggaggctttggtgaagaagggtgctaagaagcagaggctgctgtgggcctcaaccagtgtcaagaatcccgcctaccctgatactttatatgttgctcctctcattggtcctgacacggtttcaaccatgcctgaccaagctctgcaagccttcctcgatcatggaactgtttcaaggacaattgattccaatgtatcagaggctgaaggcatttacagtgcccttgagcatcttggaattgactggagctatgttggcaaccaactcgaacttgaaggagtggactctttcaagaagagttttgacagcctgcttgatactctccaagagaaggccaactctcttaaattggttagtctgtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00030 ko01100 ko01110 ko01120 ko01130 ko01200 ko01230 map00030 map01100 map01110 map01120 map01130 map01200 map01230

Pfam Domains

Protein Families

TAL_FSA

Protein Analysis

305

Amino Acids

33.37

Weight (kDa)

4.76

Isoelectric Point (pI)

21.38

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011006)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G13420
fragaria_vesca	FvH4_4g22560 FvH4_4g22560 FvH4_4g22560
malus_domestica	MD13G1131400.v1.1 MD16G1141700.v1.1
prunus_persica	Prupe.1G214200_v2.0.a1 Prupe.1G214200_v2.0.a1
pyrus_communis	pycom13g11470 pycom16g11220
rosa_chinensis	RchiOBHm_Chr4g0428801
rosa_laevigata	RLG00000007124
rosa_multiflora	Rmu_ssc0000273.1_g000001
rosa_roxburghii	Rroxscaffold_5G00370480
rosa_rugosa	Rorug04G0229100 Rorug04G0229100
rosa_samantha	Rh4AG286000 Rh4BG291800 Rh4CG307800
rosa_wichuraiana	Rw4G024790

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	220
AciI	CCGC	3 cut(s)	235, 508, 625
AcsI	RAATTY	1 cut(s)	537
AcuI	CTGAAG	2 cut(s)	184, 781
AfaI	GTAC	2 cut(s)	10, 519
AfiI	CCNNNNNNNGG	2 cut(s)	660, 887
AgsI	TTSAA	8 cut(s)	30, 66, 135, 450, 679, 730, 831, 848
AhdI	GACNNNNNGTC	1 cut(s)	216
AluBI	AGCT	4 cut(s)	80, 501, 696, 805
AluI	AGCT	4 cut(s)	80, 501, 696, 805
AlwNI	CAGNNNCTG	2 cut(s)	593, 759
AoxI	GGCC	4 cut(s)	353, 368, 601, 889
ApeKI	GCWGC	4 cut(s)	111, 180, 492, 593
ApoI	RAATTY	1 cut(s)	537
Asp700I	GAANNNNTTC	2 cut(s)	537, 725
AspS9I	GGNCC	3 cut(s)	546, 601, 663
AsuHPI	GGTGA	2 cut(s)	65, 578
AvaII	GGWCC	2 cut(s)	546, 663
BaeGI	GKGCMC	1 cut(s)	779
BbvI	GCAGC	4 cut(s)	98, 167, 479, 580
BccI	CCATC	3 cut(s)	111, 345, 547
BcgI	CGANNNNNNTGC	2 cut(s)	803, 837
BclI	TGATCA	1 cut(s)	98
BfaI	CTAG	2 cut(s)	319, 372
BfmI	CTRYAG	2 cut(s)	172, 493
BisI	GCNGC	5 cut(s)	112, 181, 493, 508, 594
BlsI	GCNGC	5 cut(s)	113, 182, 494, 509, 595
Bme18I	GGWCC	2 cut(s)	546, 663
BmeRI	GACNNNNNGTC	1 cut(s)	216
BmgT120I	GGNCC	3 cut(s)	546, 601, 663
BmiI	GGNNCC	1 cut(s)	548
BmsI	GCATC	5 cut(s)	98, 259, 292, 329, 794
BpmI	CTGGAG	3 cut(s)	368, 448, 821
BpuEI	CTTGAG	3 cut(s)	378, 487, 801
BsaXI	ACNNNNNCTCC	2 cut(s)	366, 396
Bsc4I	CCNNNNNNNGG	2 cut(s)	660, 887
Bse1I	ACTGG	2 cut(s)	610, 804
BseGI	GGATG	2 cut(s)	250, 356
BseLI	CCNNNNNNNGG	2 cut(s)	660, 887
BseMII	CTCAG	1 cut(s)	556
BseNI	ACTGG	2 cut(s)	610, 804
BseRI	GAGGAG	1 cut(s)	643
BseSI	GKGCMC	1 cut(s)	779
BseXI	GCAGC	4 cut(s)	98, 167, 479, 580
BshFI	GGCC	4 cut(s)	355, 370, 603, 891
BslFI	GGGAC	2 cut(s)	182, 532
BslI	CCNNNNNNNGG	2 cut(s)	660, 887
BsmFI	GGGAC	2 cut(s)	182, 532
BsnI	GGCC	4 cut(s)	355, 370, 603, 891
Bsp1286I	GDGCHC	1 cut(s)	779
Bsp1407I	TGTACA	1 cut(s)	8
Bsp143I	GATC	2 cut(s)	98, 713
BspACI	CCGC	3 cut(s)	235, 508, 625
BspANI	GGCC	4 cut(s)	355, 370, 603, 891
BspCNI	CTCAG	1 cut(s)	555
BspLI	GGNNCC	1 cut(s)	548
BspMAI	CTGCAG	1 cut(s)	497
BsrGI	TGTACA	1 cut(s)	8
BsrI	ACTGG	2 cut(s)	610, 804
BssMI	GATC	2 cut(s)	98, 713
Bst4CI	ACNGT	5 cut(s)	13, 173, 674, 725, 774
Bst6I	CTCTTC	1 cut(s)	846
BstAPI	GCANNNNNTGC	1 cut(s)	593
BstAUI	TGTACA	1 cut(s)	8
BstC8I	GCNNGC	4 cut(s)	74, 78, 703, 867
BstDEI	CTNAG	2 cut(s)	542, 580
BstF5I	GGATG	2 cut(s)	250, 356
BstKTI	GATC	2 cut(s)	101, 716
BstMBI	GATC	2 cut(s)	98, 713
BstMWI	GCNNNNNNNGC	6 cut(s)	498, 507, 513, 593, 702, 811
BstSFI	CTRYAG	2 cut(s)	172, 493
BstSLI	GKGCMC	1 cut(s)	779
BstV1I	GCAGC	4 cut(s)	98, 167, 479, 580
BsuRI	GGCC	4 cut(s)	355, 370, 603, 891
BtsCI	GGATG	2 cut(s)	250, 356
BtsIMutI	CAGTG	4 cut(s)	160, 293, 617, 779
Cac8I	GCNNGC	4 cut(s)	74, 78, 703, 867
CaiI	CAGNNNCTG	2 cut(s)	593, 759
Cfr13I	GGNCC	3 cut(s)	546, 601, 663
CseI	GACGC	1 cut(s)	78
Csp6I	GTAC	2 cut(s)	9, 518
CviAII	CATG	3 cut(s)	247, 683, 717
CviQI	GTAC	2 cut(s)	9, 518
DdeI	CTNAG	2 cut(s)	542, 580
DpnI	GATC	2 cut(s)	100, 715
DpnII	GATC	2 cut(s)	98, 713
DriI	GACNNNNNGTC	1 cut(s)	216
Eam1104I	CTCTTC	1 cut(s)	846
Eam1105I	GACNNNNNGTC	1 cut(s)	216
EarI	CTCTTC	1 cut(s)	846
Eco47I	GGWCC	2 cut(s)	546, 663
Eco57I	CTGAAG	2 cut(s)	184, 781
EcoO109I	RGGNCCY	1 cut(s)	546
EcoT22I	ATGCAT	1 cut(s)	252
FaeI	CATG	3 cut(s)	250, 686, 720
FalI	AAGNNNNNCTT	2 cut(s)	386, 418
FaqI	GGGAC	2 cut(s)	182, 532
FatI	CATG	3 cut(s)	246, 682, 716
FauI	CCCGC	2 cut(s)	242, 632
FbaI	TGATCA	1 cut(s)	98
FblI	GTMKAC	1 cut(s)	220
Fnu4HI	GCNGC	5 cut(s)	112, 181, 493, 508, 594
FokI	GGATG	2 cut(s)	237, 363
Fsp4HI	GCNGC	5 cut(s)	112, 181, 493, 508, 594
FspBI	CTAG	2 cut(s)	319, 372
GluI	GCNGC	5 cut(s)	112, 181, 493, 508, 594
GsuI	CTGGAG	3 cut(s)	368, 448, 821
HaeIII	GGCC	4 cut(s)	355, 370, 603, 891
HgaI	GACGC	1 cut(s)	78
Hin1II	CATG	3 cut(s)	250, 686, 720
HincII	GTYRAC	1 cut(s)	425
HindII	GTYRAC	1 cut(s)	425
HindIII	AAGCTT	1 cut(s)	78
HinfI	GANTC	6 cut(s)	87, 230, 299, 620, 741, 840
HphI	GGTGA	2 cut(s)	65, 578
Hpy166II	GTNNAC	3 cut(s)	221, 425, 839
Hpy188I	TCNGA	1 cut(s)	755
Hpy188III	TCNNGA	8 cut(s)	66, 208, 385, 465, 474, 617, 666, 848
Hpy8I	GTNNAC	3 cut(s)	221, 425, 839
HpyAV	CCTTC	9 cut(s)	50, 159, 265, 489, 566, 716, 756, 825, 881
HpyCH4III	ACNGT	5 cut(s)	13, 173, 674, 725, 774
HpyCH4V	TGCA	6 cut(s)	36, 76, 183, 250, 495, 701
HpyF10VI	GCNNNNNNNGC	6 cut(s)	498, 507, 513, 593, 702, 811
HpyF3I	CTNAG	2 cut(s)	542, 580
Hsp92II	CATG	3 cut(s)	250, 686, 720
Ksp22I	TGATCA	1 cut(s)	98
Kzo9I	GATC	2 cut(s)	98, 713
LmnI	GCTCC	3 cut(s)	248, 656, 802
Lsp1109I	GCAGC	4 cut(s)	98, 167, 479, 580
LweI	GCATC	5 cut(s)	98, 259, 292, 329, 794
MaeI	CTAG	2 cut(s)	319, 372
MaeIII	GTNAC	3 cut(s)	190, 296, 389
MalI	GATC	2 cut(s)	100, 715
MboI	GATC	2 cut(s)	98, 713
MboII	GAAGA	3 cut(s)	545, 581, 863
MfeI	CAATTG	1 cut(s)	736
MhlI	GDGCHC	1 cut(s)	779
MluCI	AATT	4 cut(s)	537, 736, 793, 903
MlyI	GAGTC	3 cut(s)	96, 293, 834
Mph1103I	ATGCAT	1 cut(s)	252
MroXI	GAANNNNTTC	2 cut(s)	537, 725
MseI	TTAA	2 cut(s)	262, 901
MunI	CAATTG	1 cut(s)	736
MwoI	GCNNNNNNNGC	6 cut(s)	498, 507, 513, 593, 702, 811
NdeII	GATC	2 cut(s)	98, 713
NlaIII	CATG	3 cut(s)	250, 686, 720
NlaIV	GGNNCC	1 cut(s)	548
NmuCI	GTSAC	1 cut(s)	296
NsiI	ATGCAT	1 cut(s)	252
PdmI	GAANNNNTTC	2 cut(s)	537, 725
PfeI	GAWTC	3 cut(s)	230, 620, 741
PkrI	GCNGC	5 cut(s)	113, 182, 494, 509, 595
PleI	GAGTC	3 cut(s)	95, 293, 834
PpsI	GAGTC	3 cut(s)	95, 293, 834
PpuMI	RGGWCCY	1 cut(s)	546
Psp5II	RGGWCCY	1 cut(s)	546
PspN4I	GGNNCC	1 cut(s)	548
PspPI	GGNCC	3 cut(s)	546, 601, 663
PspPPI	RGGWCCY	1 cut(s)	546
PstI	CTGCAG	1 cut(s)	497
PstNI	CAGNNNCTG	2 cut(s)	593, 759
RsaI	GTAC	2 cut(s)	10, 519
RsaNI	GTAC	2 cut(s)	9, 518
SaqAI	TTAA	2 cut(s)	262, 901
SatI	GCNGC	5 cut(s)	112, 181, 493, 508, 594
Sau3AI	GATC	2 cut(s)	98, 713
Sau96I	GGNCC	3 cut(s)	546, 601, 663
SchI	GAGTC	3 cut(s)	96, 293, 834
SduI	GDGCHC	1 cut(s)	779
SetI	ASST	7 cut(s)	82, 382, 481, 503, 548, 698, 807
SfaNI	GCATC	5 cut(s)	98, 259, 292, 329, 794
SfcI	CTRYAG	2 cut(s)	172, 493
SinI	GGWCC	2 cut(s)	546, 663
SmlI	CTYRAG	3 cut(s)	357, 502, 780
SmoI	CTYRAG	3 cut(s)	357, 502, 780
Sse9I	AATT	4 cut(s)	537, 736, 793, 903
SsiI	CCGC	3 cut(s)	235, 508, 625
SspMI	CTAG	2 cut(s)	319, 372
TaaI	ACNGT	5 cut(s)	13, 173, 674, 725, 774
TaqI	TCGA	3 cut(s)	482, 712, 823
TasI	AATT	4 cut(s)	537, 736, 793, 903
TatI	WGTACW	1 cut(s)	8
TauI	GCSGC	1 cut(s)	510
TfiI	GAWTC	3 cut(s)	230, 620, 741
Tru1I	TTAA	2 cut(s)	262, 901
Tru9I	TTAA	2 cut(s)	262, 901
TscAI	CASTG	4 cut(s)	167, 293, 617, 779
TseFI	GTSAC	1 cut(s)	296
TseI	GCWGC	4 cut(s)	111, 180, 492, 593
Tsp45I	GTSAC	1 cut(s)	296
TspRI	CASTG	4 cut(s)	167, 293, 617, 779
VpaK11BI	GGWCC	2 cut(s)	546, 663
XapI	RAATTY	1 cut(s)	537
XmiI	GTMKAC	1 cut(s)	220
XmnI	GAANNNNTTC	2 cut(s)	537, 725
XspI	CTAG	2 cut(s)	319, 372
Zsp2I	ATGCAT	1 cut(s)	252

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.