Rmu_ssc0000273.1_g000001

Transaldolase/Fructose-6-phosphate aldolase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000273.1
OG0011006
Physical Location & Seq
Forward (+)
1 .. 1966
1966 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 919 bp
ggaacttgtacagtcagggaaagacattgaaactgcatattgggaacttgtggtgaaggacattcaagacgcttgcaagctttttgagtcaatctatgatcaaactgatgctgctgatggctatgtttctgttgaagtttctcccagacttgctgatgacactgaagggactgtagaggctgcaaaatggttacataaagttgtttcccgacccaatgtctacataaagattcccgctactgctccatgcatcccttctattaaggaagttatagcaaatggcatcagtgtcaatgtgactcttatattctctctcactagatatgaggcagtcattgatgcgtatttggatggccttgaggcttctggcctagacgacctctccagagtaacaagtgttgcttctttctttgtcagtagggttgacacccttattgacaagttgcttgaaaagattggaactccagaggctcttgaccttcgaggaaaggctgcagtagctcaagccgctttagcgtaccaactataccagaagaaattctcaggtcccagatgggaggctttggtgaagaagggtgctaagaagcagaggctgctgtgggcctcaaccagtgtcaagaatcccgcctaccctgatactttatatgttgctcctctcattggtcctgacacggtttcaaccatgcctgaccaagctctgcaagccttcctcgatcatggaactgtttcaaggacaattgattccaatgtatcagaggctgaaggcatttacagtgcccttgagcatcttggaattgactggagctatgttggcaaccaactcgaacttgaaggagtggactctttcaagaagagttttgacagcctgcttgatactctccaagagaaggccaactctcttaaattggttagtctgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00030 ko01100 ko01110 ko01120 ko01130 ko01200 ko01230 map00030 map01100 map01110 map01120 map01130 map01200 map01230
Pfam Domains
Protein Families
TAL_FSA

Protein Analysis

305

Amino Acids

33.37

Weight (kDa)

4.76

Isoelectric Point (pI)

21.38

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TAL_FSA PF00923 3 - 292 2.3e-66 Transaldolase/Fructose-6-phosphate aldolase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011006)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G13420
fragaria_vesca FvH4_4g22560 FvH4_4g22560 FvH4_4g22560
malus_domestica MD13G1131400.v1.1 MD16G1141700.v1.1
prunus_persica Prupe.1G214200_v2.0.a1 Prupe.1G214200_v2.0.a1
pyrus_communis pycom13g11470 pycom16g11220
rosa_chinensis RchiOBHm_Chr4g0428801
rosa_laevigata RLG00000007124
rosa_multiflora Rmu_ssc0000273.1_g000001
rosa_roxburghii Rroxscaffold_5G00370480
rosa_rugosa Rorug04G0229100 Rorug04G0229100
rosa_samantha Rh4AG286000 Rh4BG291800 Rh4CG307800
rosa_wichuraiana Rw4G024790

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 220
AciI CCGC 3 cut(s) 235, 508, 625
AcsI RAATTY 1 cut(s) 537
AcuI CTGAAG 2 cut(s) 184, 781
AfaI GTAC 2 cut(s) 10, 519
AfiI CCNNNNNNNGG 2 cut(s) 660, 887
AgsI TTSAA 8 cut(s) 30, 66, 135, 450, 679, 730, 831, 848
AhdI GACNNNNNGTC 1 cut(s) 216
AluBI AGCT 4 cut(s) 80, 501, 696, 805
AluI AGCT 4 cut(s) 80, 501, 696, 805
AlwNI CAGNNNCTG 2 cut(s) 593, 759
AoxI GGCC 4 cut(s) 353, 368, 601, 889
ApeKI GCWGC 4 cut(s) 111, 180, 492, 593
ApoI RAATTY 1 cut(s) 537
Asp700I GAANNNNTTC 2 cut(s) 537, 725
AspS9I GGNCC 3 cut(s) 546, 601, 663
AsuHPI GGTGA 2 cut(s) 65, 578
AvaII GGWCC 2 cut(s) 546, 663
BaeGI GKGCMC 1 cut(s) 779
BbvI GCAGC 4 cut(s) 98, 167, 479, 580
BccI CCATC 3 cut(s) 111, 345, 547
BcgI CGANNNNNNTGC 2 cut(s) 803, 837
BclI TGATCA 1 cut(s) 98
BfaI CTAG 2 cut(s) 319, 372
BfmI CTRYAG 2 cut(s) 172, 493
BisI GCNGC 5 cut(s) 112, 181, 493, 508, 594
BlsI GCNGC 5 cut(s) 113, 182, 494, 509, 595
Bme18I GGWCC 2 cut(s) 546, 663
BmeRI GACNNNNNGTC 1 cut(s) 216
BmgT120I GGNCC 3 cut(s) 546, 601, 663
BmiI GGNNCC 1 cut(s) 548
BmsI GCATC 5 cut(s) 98, 259, 292, 329, 794
BpmI CTGGAG 3 cut(s) 368, 448, 821
BpuEI CTTGAG 3 cut(s) 378, 487, 801
BsaXI ACNNNNNCTCC 2 cut(s) 366, 396
Bsc4I CCNNNNNNNGG 2 cut(s) 660, 887
Bse1I ACTGG 2 cut(s) 610, 804
BseGI GGATG 2 cut(s) 250, 356
BseLI CCNNNNNNNGG 2 cut(s) 660, 887
BseMII CTCAG 1 cut(s) 556
BseNI ACTGG 2 cut(s) 610, 804
BseRI GAGGAG 1 cut(s) 643
BseSI GKGCMC 1 cut(s) 779
BseXI GCAGC 4 cut(s) 98, 167, 479, 580
BshFI GGCC 4 cut(s) 355, 370, 603, 891
BslFI GGGAC 2 cut(s) 182, 532
BslI CCNNNNNNNGG 2 cut(s) 660, 887
BsmFI GGGAC 2 cut(s) 182, 532
BsnI GGCC 4 cut(s) 355, 370, 603, 891
Bsp1286I GDGCHC 1 cut(s) 779
Bsp1407I TGTACA 1 cut(s) 8
Bsp143I GATC 2 cut(s) 98, 713
BspACI CCGC 3 cut(s) 235, 508, 625
BspANI GGCC 4 cut(s) 355, 370, 603, 891
BspCNI CTCAG 1 cut(s) 555
BspLI GGNNCC 1 cut(s) 548
BspMAI CTGCAG 1 cut(s) 497
BsrGI TGTACA 1 cut(s) 8
BsrI ACTGG 2 cut(s) 610, 804
BssMI GATC 2 cut(s) 98, 713
Bst4CI ACNGT 5 cut(s) 13, 173, 674, 725, 774
Bst6I CTCTTC 1 cut(s) 846
BstAPI GCANNNNNTGC 1 cut(s) 593
BstAUI TGTACA 1 cut(s) 8
BstC8I GCNNGC 4 cut(s) 74, 78, 703, 867
BstDEI CTNAG 2 cut(s) 542, 580
BstF5I GGATG 2 cut(s) 250, 356
BstKTI GATC 2 cut(s) 101, 716
BstMBI GATC 2 cut(s) 98, 713
BstMWI GCNNNNNNNGC 6 cut(s) 498, 507, 513, 593, 702, 811
BstSFI CTRYAG 2 cut(s) 172, 493
BstSLI GKGCMC 1 cut(s) 779
BstV1I GCAGC 4 cut(s) 98, 167, 479, 580
BsuRI GGCC 4 cut(s) 355, 370, 603, 891
BtsCI GGATG 2 cut(s) 250, 356
BtsIMutI CAGTG 4 cut(s) 160, 293, 617, 779
Cac8I GCNNGC 4 cut(s) 74, 78, 703, 867
CaiI CAGNNNCTG 2 cut(s) 593, 759
Cfr13I GGNCC 3 cut(s) 546, 601, 663
CseI GACGC 1 cut(s) 78
Csp6I GTAC 2 cut(s) 9, 518
CviAII CATG 3 cut(s) 247, 683, 717
CviQI GTAC 2 cut(s) 9, 518
DdeI CTNAG 2 cut(s) 542, 580
DpnI GATC 2 cut(s) 100, 715
DpnII GATC 2 cut(s) 98, 713
DriI GACNNNNNGTC 1 cut(s) 216
Eam1104I CTCTTC 1 cut(s) 846
Eam1105I GACNNNNNGTC 1 cut(s) 216
EarI CTCTTC 1 cut(s) 846
Eco47I GGWCC 2 cut(s) 546, 663
Eco57I CTGAAG 2 cut(s) 184, 781
EcoO109I RGGNCCY 1 cut(s) 546
EcoT22I ATGCAT 1 cut(s) 252
FaeI CATG 3 cut(s) 250, 686, 720
FalI AAGNNNNNCTT 2 cut(s) 386, 418
FaqI GGGAC 2 cut(s) 182, 532
FatI CATG 3 cut(s) 246, 682, 716
FauI CCCGC 2 cut(s) 242, 632
FbaI TGATCA 1 cut(s) 98
FblI GTMKAC 1 cut(s) 220
Fnu4HI GCNGC 5 cut(s) 112, 181, 493, 508, 594
FokI GGATG 2 cut(s) 237, 363
Fsp4HI GCNGC 5 cut(s) 112, 181, 493, 508, 594
FspBI CTAG 2 cut(s) 319, 372
GluI GCNGC 5 cut(s) 112, 181, 493, 508, 594
GsuI CTGGAG 3 cut(s) 368, 448, 821
HaeIII GGCC 4 cut(s) 355, 370, 603, 891
HgaI GACGC 1 cut(s) 78
Hin1II CATG 3 cut(s) 250, 686, 720
HincII GTYRAC 1 cut(s) 425
HindII GTYRAC 1 cut(s) 425
HindIII AAGCTT 1 cut(s) 78
HinfI GANTC 6 cut(s) 87, 230, 299, 620, 741, 840
HphI GGTGA 2 cut(s) 65, 578
Hpy166II GTNNAC 3 cut(s) 221, 425, 839
Hpy188I TCNGA 1 cut(s) 755
Hpy188III TCNNGA 8 cut(s) 66, 208, 385, 465, 474, 617, 666, 848
Hpy8I GTNNAC 3 cut(s) 221, 425, 839
HpyAV CCTTC 9 cut(s) 50, 159, 265, 489, 566, 716, 756, 825, 881
HpyCH4III ACNGT 5 cut(s) 13, 173, 674, 725, 774
HpyCH4V TGCA 6 cut(s) 36, 76, 183, 250, 495, 701
HpyF10VI GCNNNNNNNGC 6 cut(s) 498, 507, 513, 593, 702, 811
HpyF3I CTNAG 2 cut(s) 542, 580
Hsp92II CATG 3 cut(s) 250, 686, 720
Ksp22I TGATCA 1 cut(s) 98
Kzo9I GATC 2 cut(s) 98, 713
LmnI GCTCC 3 cut(s) 248, 656, 802
Lsp1109I GCAGC 4 cut(s) 98, 167, 479, 580
LweI GCATC 5 cut(s) 98, 259, 292, 329, 794
MaeI CTAG 2 cut(s) 319, 372
MaeIII GTNAC 3 cut(s) 190, 296, 389
MalI GATC 2 cut(s) 100, 715
MboI GATC 2 cut(s) 98, 713
MboII GAAGA 3 cut(s) 545, 581, 863
MfeI CAATTG 1 cut(s) 736
MhlI GDGCHC 1 cut(s) 779
MluCI AATT 4 cut(s) 537, 736, 793, 903
MlyI GAGTC 3 cut(s) 96, 293, 834
Mph1103I ATGCAT 1 cut(s) 252
MroXI GAANNNNTTC 2 cut(s) 537, 725
MseI TTAA 2 cut(s) 262, 901
MunI CAATTG 1 cut(s) 736
MwoI GCNNNNNNNGC 6 cut(s) 498, 507, 513, 593, 702, 811
NdeII GATC 2 cut(s) 98, 713
NlaIII CATG 3 cut(s) 250, 686, 720
NlaIV GGNNCC 1 cut(s) 548
NmuCI GTSAC 1 cut(s) 296
NsiI ATGCAT 1 cut(s) 252
PdmI GAANNNNTTC 2 cut(s) 537, 725
PfeI GAWTC 3 cut(s) 230, 620, 741
PkrI GCNGC 5 cut(s) 113, 182, 494, 509, 595
PleI GAGTC 3 cut(s) 95, 293, 834
PpsI GAGTC 3 cut(s) 95, 293, 834
PpuMI RGGWCCY 1 cut(s) 546
Psp5II RGGWCCY 1 cut(s) 546
PspN4I GGNNCC 1 cut(s) 548
PspPI GGNCC 3 cut(s) 546, 601, 663
PspPPI RGGWCCY 1 cut(s) 546
PstI CTGCAG 1 cut(s) 497
PstNI CAGNNNCTG 2 cut(s) 593, 759
RsaI GTAC 2 cut(s) 10, 519
RsaNI GTAC 2 cut(s) 9, 518
SaqAI TTAA 2 cut(s) 262, 901
SatI GCNGC 5 cut(s) 112, 181, 493, 508, 594
Sau3AI GATC 2 cut(s) 98, 713
Sau96I GGNCC 3 cut(s) 546, 601, 663
SchI GAGTC 3 cut(s) 96, 293, 834
SduI GDGCHC 1 cut(s) 779
SetI ASST 7 cut(s) 82, 382, 481, 503, 548, 698, 807
SfaNI GCATC 5 cut(s) 98, 259, 292, 329, 794
SfcI CTRYAG 2 cut(s) 172, 493
SinI GGWCC 2 cut(s) 546, 663
SmlI CTYRAG 3 cut(s) 357, 502, 780
SmoI CTYRAG 3 cut(s) 357, 502, 780
Sse9I AATT 4 cut(s) 537, 736, 793, 903
SsiI CCGC 3 cut(s) 235, 508, 625
SspMI CTAG 2 cut(s) 319, 372
TaaI ACNGT 5 cut(s) 13, 173, 674, 725, 774
TaqI TCGA 3 cut(s) 482, 712, 823
TasI AATT 4 cut(s) 537, 736, 793, 903
TatI WGTACW 1 cut(s) 8
TauI GCSGC 1 cut(s) 510
TfiI GAWTC 3 cut(s) 230, 620, 741
Tru1I TTAA 2 cut(s) 262, 901
Tru9I TTAA 2 cut(s) 262, 901
TscAI CASTG 4 cut(s) 167, 293, 617, 779
TseFI GTSAC 1 cut(s) 296
TseI GCWGC 4 cut(s) 111, 180, 492, 593
Tsp45I GTSAC 1 cut(s) 296
TspRI CASTG 4 cut(s) 167, 293, 617, 779
VpaK11BI GGWCC 2 cut(s) 546, 663
XapI RAATTY 1 cut(s) 537
XmiI GTMKAC 1 cut(s) 220
XmnI GAANNNNTTC 2 cut(s) 537, 725
XspI CTAG 2 cut(s) 319, 372
Zsp2I ATGCAT 1 cut(s) 252
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.