Rroxscaffold_1G00024720

Belongs to the cation transport ATPase (P-type) (TC 3.A.3) family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
30730503 .. 30732583
2081 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00024720.1

Sequence Viewer

Length: 261 bp
ATGTCACTTAATTTTCTGTCATGCATGGTCCACTTATTACAGGTTGCAAAGGAAGCCTCTAATATGGTATTAGCATATGACAATTTTAGCACTATAGTTTCTGTTGTTGGAGAAGGCATATCTATTTACAACAACATGAAGCCTTTTATCAAGTTGGATTCATCTCTATTTAAGATGTCATCTAATAAGAGACTTGAAAAGTTTTTCAAATATGAATGTAACTCTTCCTATCCAATCTTATTTGAACTTGCATCAAGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

86

Amino Acids

9.76

Weight (kDa)

7.75

Isoelectric Point (pI)

51.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018490)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 3 cut(s) 197, 208, 245
Alw26I GTCTC 1 cut(s) 184
AspS9I GGNCC 1 cut(s) 28
AvaII GGWCC 1 cut(s) 28
BcoDI GTCTC 1 cut(s) 184
BfmI CTRYAG 1 cut(s) 93
Bme18I GGWCC 1 cut(s) 28
BmgT120I GGNCC 1 cut(s) 28
BsmAI GTCTC 1 cut(s) 184
Bst6I CTCTTC 1 cut(s) 229
BstMAI GTCTC 1 cut(s) 184
BstMWI GCNNNNNNNGC 1 cut(s) 53
BstSFI CTRYAG 1 cut(s) 93
Cfr13I GGNCC 1 cut(s) 28
CviAII CATG 3 cut(s) 21, 25, 136
CviJI RGCY 2 cut(s) 56, 142
CviKI_1 RGCY 2 cut(s) 56, 142
Eam1104I CTCTTC 1 cut(s) 229
EarI CTCTTC 1 cut(s) 229
Eco47I GGWCC 1 cut(s) 28
EcoT22I ATGCAT 1 cut(s) 26
FaeI CATG 3 cut(s) 24, 28, 139
FaiI YATR 9 cut(s) 22, 26, 65, 76, 78, 95, 119, 137, 213
FatI CATG 3 cut(s) 20, 24, 135
FauNDI CATATG 1 cut(s) 76
Hin1II CATG 3 cut(s) 24, 28, 139
HinfI GANTC 1 cut(s) 158
Hpy166II GTNNAC 1 cut(s) 31
Hpy8I GTNNAC 1 cut(s) 31
HpyAV CCTTC 1 cut(s) 107
HpyCH4V TGCA 3 cut(s) 24, 47, 251
HpyF10VI GCNNNNNNNGC 1 cut(s) 53
Hsp92II CATG 3 cut(s) 24, 28, 139
LpnPI CCDG 1 cut(s) 26
MaeIII GTNAC 2 cut(s) 3, 218
MboII GAAGA 1 cut(s) 216
MluCI AATT 2 cut(s) 10, 82
MmeI TCCRAC 2 cut(s) 88, 135
MnlI CCTC 1 cut(s) 67
Mph1103I ATGCAT 1 cut(s) 26
MseI TTAA 2 cut(s) 9, 171
MwoI GCNNNNNNNGC 1 cut(s) 53
NdeI CATATG 1 cut(s) 76
NlaIII CATG 3 cut(s) 24, 28, 139
NmuCI GTSAC 1 cut(s) 3
NsiI ATGCAT 1 cut(s) 26
PfeI GAWTC 1 cut(s) 158
PspPI GGNCC 1 cut(s) 28
SaqAI TTAA 2 cut(s) 9, 171
Sau96I GGNCC 1 cut(s) 28
SetI ASST 1 cut(s) 45
SfcI CTRYAG 1 cut(s) 93
SgeI CNNG 6 cut(s) 33, 37, 53, 148, 163, 206
SinI GGWCC 1 cut(s) 28
Sse9I AATT 2 cut(s) 10, 82
TasI AATT 2 cut(s) 10, 82
TfiI GAWTC 1 cut(s) 158
Tru1I TTAA 2 cut(s) 9, 171
Tru9I TTAA 2 cut(s) 9, 171
TseFI GTSAC 1 cut(s) 3
Tsp45I GTSAC 1 cut(s) 3
TspDTI ATGAA 3 cut(s) 150, 152, 228
VpaK11BI GGWCC 1 cut(s) 28
Zsp2I ATGCAT 1 cut(s) 26
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.