Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000001

Orthogroup ID

OG0018172

Physical Location & Seq

Genomic Coordinates Reverse (-)

78836023 .. 78836397

Gene Structure 375 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_1G00056880.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 201 bp

ATGAGGTTTGGAACTACAACCACACCAAAGATTCCCTCCTCTCTCGGTAACCTCTCAAACTTGAACTATTTGGACCTCAAATCTTTTTATTGGACTGTTTCTTCCAAAAACTTGAATTCCAAAAACTTGAATTGGCTTTCTCATCTATCTTCCTTAAAATATCTCAATCTCGGAGGTGTGAACCTCAACCTCACGGAGTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0003006 GO:0005575 GO:0005618 GO:0005623 GO:0007275 GO:0007389 GO:0008150 GO:0009505 GO:0009531 GO:0009553 GO:0009653 GO:0009790 GO:0009791 GO:0009793 GO:0009798 GO:0009888 GO:0010154 GO:0010453 GO:0022414 GO:0022603 GO:0030312 GO:0032501 GO:0032502 GO:0042659 GO:0044426 GO:0044462 GO:0044464 GO:0045595 GO:0048226 GO:0048229 GO:0048316 GO:0048608 GO:0048731 GO:0048856 GO:0050789 GO:0050793 GO:0050794 GO:0051239 GO:0051302 GO:0061458 GO:0065001 GO:0065007 GO:0071944 GO:0090558 GO:0090708 GO:0099402 GO:1905392 GO:1905421 GO:2000026 GO:2000067 GO:2000280

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

LRRNT_2 LRR_1 LRR_6 LRR_8

Protein Analysis

66

Amino Acids

7.42

Weight (kDa)

9.78

Isoelectric Point (pI)

19.69

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018172)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr3g0483981 RchiOBHm_Chr4g0440621 RchiOBHm_Chr5g0022631
rosa_multiflora	Rmu_sc0001784.1_g000005
rosa_roxburghii	Rroxscaffold_1G00056880 Rroxscaffold_5G00381440 Rroxscaffold_6G00397910
rosa_rugosa	Rorug01G0268600
rosa_samantha	Rh1AG250800 Rh1CG234600 Rh4DG385500

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	115
AgsI	TTSAA	3 cut(s)	64, 115, 130
ApoI	RAATTY	1 cut(s)	115
AspS9I	GGNCC	1 cut(s)	73
AvaII	GGWCC	1 cut(s)	73
Bme18I	GGWCC	1 cut(s)	73
BmgT120I	GGNCC	1 cut(s)	73
BseRI	GAGGAG	1 cut(s)	28
Bst4CI	ACNGT	1 cut(s)	97
BstEII	GGTNACC	1 cut(s)	47
BstPI	GGTNACC	1 cut(s)	47
Cfr13I	GGNCC	1 cut(s)	73
CviJI	RGCY	1 cut(s)	136
CviKI_1	RGCY	1 cut(s)	136
Eco47I	GGWCC	1 cut(s)	73
Eco91I	GGTNACC	1 cut(s)	47
EcoO65I	GGTNACC	1 cut(s)	47
EcoRI	GAATTC	1 cut(s)	115
HinfI	GANTC	1 cut(s)	31
Hpy166II	GTNNAC	1 cut(s)	181
Hpy188I	TCNGA	1 cut(s)	173
Hpy8I	GTNNAC	1 cut(s)	181
HpyCH4III	ACNGT	1 cut(s)	97
MaeIII	GTNAC	1 cut(s)	47
MboII	GAAGA	2 cut(s)	93, 141
MluCI	AATT	2 cut(s)	115, 130
MnlI	CCTC	7 cut(s)	46, 49, 62, 86, 167, 194, 200
MseI	TTAA	1 cut(s)	155
PfeI	GAWTC	1 cut(s)	31
PspEI	GGTNACC	1 cut(s)	47
PspPI	GGNCC	1 cut(s)	73
SaqAI	TTAA	1 cut(s)	155
Sau96I	GGNCC	1 cut(s)	73
SetI	ASST	6 cut(s)	8, 54, 78, 178, 186, 192
SgeI	CNNG	5 cut(s)	56, 73, 124, 139, 182
SinI	GGWCC	1 cut(s)	73
Sse9I	AATT	2 cut(s)	115, 130
TaaI	ACNGT	1 cut(s)	97
TasI	AATT	2 cut(s)	115, 130
TfiI	GAWTC	1 cut(s)	31
Tru1I	TTAA	1 cut(s)	155
Tru9I	TTAA	1 cut(s)	155
VpaK11BI	GGWCC	1 cut(s)	73
XapI	RAATTY	1 cut(s)	115

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.