Rroxscaffold_1G00064440

Multidrug pheromone exporter, MDR family, ABC transporter family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
86237267 .. 86239363
2097 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00064440.1

Sequence Viewer

Length: 198 bp
ATGGCTTTGCCACATGTGAGAGGAGAAATAGAGTTCCAAGACATATACTTCAGTTATCCATCAAGACCTGACAGCCAACTCTTACAAGGCTTGAATCTTAACATTTCGGCTGGTAAGAGTGTAGGTCTAGTTGGGGGAAGTGGCTTTGGCAAGTTGACAATGATTTCAGTGATTGAAAAATTTTATGAACCAGGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

65

Amino Acids

7.06

Weight (kDa)

5.6

Isoelectric Point (pI)

61.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 179
AcuI CTGAAG 1 cut(s) 34
AflIII ACRYGT 1 cut(s) 13
AgsI TTSAA 2 cut(s) 94, 176
AjnI CCWGG 1 cut(s) 190
ApoI RAATTY 1 cut(s) 179
BccI CCATC 1 cut(s) 67
BciT130I CCWGG 1 cut(s) 192
BfaI CTAG 1 cut(s) 128
Bme1390I CCNGG 1 cut(s) 192
BmrFI CCNGG 1 cut(s) 192
BseBI CCWGG 1 cut(s) 192
BseRI GAGGAG 1 cut(s) 36
Bst2UI CCWGG 1 cut(s) 192
BstNI CCWGG 1 cut(s) 192
BstNSI RCATGY 1 cut(s) 17
BstSCI CCNGG 1 cut(s) 190
BtsIMutI CAGTG 1 cut(s) 174
CsiI ACCWGGT 1 cut(s) 190
CviAII CATG 1 cut(s) 14
CviJI RGCY 5 cut(s) 5, 75, 90, 110, 144
CviKI_1 RGCY 5 cut(s) 5, 75, 90, 110, 144
Eco57I CTGAAG 1 cut(s) 34
EcoRII CCWGG 1 cut(s) 190
FaeI CATG 1 cut(s) 17
FaiI YATR 4 cut(s) 15, 44, 46, 186
FatI CATG 1 cut(s) 13
FspBI CTAG 1 cut(s) 128
Hin1II CATG 1 cut(s) 17
HincII GTYRAC 1 cut(s) 156
HindII GTYRAC 1 cut(s) 156
HinfI GANTC 1 cut(s) 94
Hpy166II GTNNAC 1 cut(s) 156
Hpy188III TCNNGA 1 cut(s) 63
Hpy8I GTNNAC 1 cut(s) 156
Hsp92II CATG 1 cut(s) 17
LpnPI CCDG 3 cut(s) 81, 96, 177
MabI ACCWGGT 1 cut(s) 190
MaeI CTAG 1 cut(s) 128
MluCI AATT 1 cut(s) 179
MnlI CCTC 1 cut(s) 14
MseI TTAA 1 cut(s) 99
MspR9I CCNGG 1 cut(s) 192
MvaI CCWGG 1 cut(s) 192
NlaIII CATG 1 cut(s) 17
NspI RCATGY 1 cut(s) 17
PciI ACATGT 1 cut(s) 13
PfeI GAWTC 1 cut(s) 94
PscI ACATGT 1 cut(s) 13
Psp6I CCWGG 1 cut(s) 190
PspGI CCWGG 1 cut(s) 190
SaqAI TTAA 1 cut(s) 99
ScrFI CCNGG 1 cut(s) 192
SetI ASST 3 cut(s) 70, 127, 196
SexAI ACCWGGT 1 cut(s) 190
SgeI CNNG 9 cut(s) 26, 50, 75, 80, 98, 103, 123, 140, 163
Sse9I AATT 1 cut(s) 179
SspMI CTAG 1 cut(s) 128
StyD4I CCNGG 1 cut(s) 190
TasI AATT 1 cut(s) 179
TfiI GAWTC 1 cut(s) 94
Tru1I TTAA 1 cut(s) 99
Tru9I TTAA 1 cut(s) 99
TscAI CASTG 1 cut(s) 174
TspRI CASTG 1 cut(s) 174
XapI RAATTY 1 cut(s) 179
XceI RCATGY 1 cut(s) 17
XspI CTAG 1 cut(s) 128
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.