Rroxscaffold_2G00116380

LRR receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
43516871 .. 43534421
17551 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00116380.1

Sequence Viewer

Length: 330 bp
ATGGATTACGAACCAATCGTAGTTAATGTCATCATTGTGATTGTTCTTTCCATTAGAGGCTACAATGTAAACTGGTTTATTATAGGTCCTATTTCTAAGACTTCACACAATATCACATCTCTCAGGGAAATAGATCTCTCCATGGAATTTCTTAATCTTCCGATACCTGAGTGGTTGTATAGTTTGAACCATCTTGAGTCCTTAATTATTTCTACCAATGCCTTTCACTGTGAAATTTCAAGTTCCATTGGGAACTTAACATTCATCATCAACCTAGAGTTGGGTTCAAATATTTTGGAAGGGAAGATCCCAAACTCATCGAGAAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

109

Amino Acids

12.28

Weight (kDa)

4.93

Isoelectric Point (pI)

33.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 301
AcsI RAATTY 2 cut(s) 146, 234
AfiI CCNNNNNNNGG 1 cut(s) 280
AgsI TTSAA 3 cut(s) 187, 240, 288
AlwI GGATC 1 cut(s) 301
ApoI RAATTY 2 cut(s) 146, 234
AspS9I GGNCC 1 cut(s) 86
AvaII GGWCC 1 cut(s) 86
BaeI ACNNNNGTAYC 2 cut(s) 155, 188
BccI CCATC 1 cut(s) 198
BfaI CTAG 1 cut(s) 275
BglII AGATCT 1 cut(s) 133
Bme18I GGWCC 1 cut(s) 86
BmgT120I GGNCC 1 cut(s) 86
BpuEI CTTGAG 1 cut(s) 215
BsaJI CCNNGG 1 cut(s) 141
Bsc4I CCNNNNNNNGG 1 cut(s) 280
Bse1I ACTGG 1 cut(s) 77
BseDI CCNNGG 1 cut(s) 141
BseLI CCNNNNNNNGG 1 cut(s) 280
BseMII CTCAG 2 cut(s) 136, 159
BseNI ACTGG 1 cut(s) 77
BslI CCNNNNNNNGG 1 cut(s) 280
Bsp143I GATC 2 cut(s) 133, 306
Bsp19I CCATGG 1 cut(s) 141
BspCNI CTCAG 2 cut(s) 135, 160
BspPI GGATC 1 cut(s) 301
BsrI ACTGG 1 cut(s) 77
BssECI CCNNGG 1 cut(s) 141
BssMI GATC 2 cut(s) 133, 306
BssT1I CCWWGG 1 cut(s) 141
Bst4CI ACNGT 1 cut(s) 230
BstDEI CTNAG 3 cut(s) 96, 122, 168
BstDSI CCRYGG 1 cut(s) 141
BstKTI GATC 2 cut(s) 136, 309
BstMBI GATC 2 cut(s) 133, 306
BstX2I RGATCY 2 cut(s) 133, 306
BstYI RGATCY 2 cut(s) 133, 306
BtgI CCRYGG 1 cut(s) 141
BtsIMutI CAGTG 1 cut(s) 226
Cfr13I GGNCC 1 cut(s) 86
CviAII CATG 1 cut(s) 142
CviJI RGCY 1 cut(s) 60
CviKI_1 RGCY 1 cut(s) 60
DdeI CTNAG 3 cut(s) 96, 122, 168
DpnI GATC 2 cut(s) 135, 308
DpnII GATC 2 cut(s) 133, 306
Eco130I CCWWGG 1 cut(s) 141
Eco47I GGWCC 1 cut(s) 86
EcoO109I RGGNCCY 1 cut(s) 86
EcoT14I CCWWGG 1 cut(s) 141
ErhI CCWWGG 1 cut(s) 141
FaeI CATG 1 cut(s) 145
FaiI YATR 3 cut(s) 83, 143, 180
FatI CATG 1 cut(s) 141
FspBI CTAG 1 cut(s) 275
Hin1II CATG 1 cut(s) 145
HinfI GANTC 1 cut(s) 197
Hpy166II GTNNAC 1 cut(s) 70
Hpy188I TCNGA 1 cut(s) 162
Hpy188III TCNNGA 2 cut(s) 194, 321
Hpy8I GTNNAC 1 cut(s) 70
HpyAV CCTTC 1 cut(s) 293
HpyCH4III ACNGT 1 cut(s) 230
HpyF3I CTNAG 3 cut(s) 96, 122, 168
Hsp92II CATG 1 cut(s) 145
Kzo9I GATC 2 cut(s) 133, 306
LpnPI CCDG 3 cut(s) 58, 109, 180
MaeI CTAG 1 cut(s) 275
MalI GATC 2 cut(s) 135, 308
MboI GATC 2 cut(s) 133, 306
MboII GAAGA 2 cut(s) 149, 316
MflI RGATCY 2 cut(s) 133, 306
MluCI AATT 4 cut(s) 146, 204, 234, 325
MlyI GAGTC 1 cut(s) 206
MnlI CCTC 1 cut(s) 50
MseI TTAA 5 cut(s) 24, 153, 203, 257, 328
MslI CAYNNNNRTG 1 cut(s) 35
NcoI CCATGG 1 cut(s) 141
NdeII GATC 2 cut(s) 133, 306
NlaIII CATG 1 cut(s) 145
PcsI WCGNNNNNNNCGW 1 cut(s) 15
PleI GAGTC 1 cut(s) 205
PpsI GAGTC 1 cut(s) 205
PpuMI RGGWCCY 1 cut(s) 86
Psp5II RGGWCCY 1 cut(s) 86
PspPI GGNCC 1 cut(s) 86
PspPPI RGGWCCY 1 cut(s) 86
PsuI RGATCY 2 cut(s) 133, 306
RseI CAYNNNNRTG 1 cut(s) 35
SaqAI TTAA 5 cut(s) 24, 153, 203, 257, 328
Sau3AI GATC 2 cut(s) 133, 306
Sau96I GGNCC 1 cut(s) 86
SchI GAGTC 1 cut(s) 206
SetI ASST 3 cut(s) 88, 169, 276
SgeI CNNG 7 cut(s) 85, 136, 154, 179, 206, 252, 287
SinI GGWCC 1 cut(s) 86
SmiMI CAYNNNNRTG 1 cut(s) 35
SmlI CTYRAG 1 cut(s) 194
SmoI CTYRAG 1 cut(s) 194
Sse9I AATT 4 cut(s) 146, 204, 234, 325
SspI AATATT 1 cut(s) 292
SspMI CTAG 1 cut(s) 275
StyI CCWWGG 1 cut(s) 141
TaaI ACNGT 1 cut(s) 230
TaqI TCGA 1 cut(s) 320
TasI AATT 4 cut(s) 146, 204, 234, 325
Tru1I TTAA 5 cut(s) 24, 153, 203, 257, 328
Tru9I TTAA 5 cut(s) 24, 153, 203, 257, 328
TscAI CASTG 1 cut(s) 233
TspDTI ATGAA 1 cut(s) 253
TspRI CASTG 1 cut(s) 233
VpaK11BI GGWCC 1 cut(s) 86
XapI RAATTY 2 cut(s) 146, 234
XspI CTAG 1 cut(s) 275
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.