Rroxscaffold_3G00234610

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Reverse (-)
21115281 .. 21116112
832 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00234610.1

Sequence Viewer

Length: 258 bp
ATGGTCAATGCTGACCTAGCTGAAGTTGAGATGACCGTAAATGAGCTAGAAGCAAACTCTGACTGCTCGTATTCTATTGCAGCGATCATATGTGGTGGTTGCATGAGGGTTTTGACAGTCATAAGTGGCATGATCCCTAACCTGCATAGCTCCCATCACCCAACCACTCCTATGGATAAGAGTGGCATGCTAGACTGGCTCTCGTGGCTTTCGTGTGCGAATCCTGAACAAAAGAGGCCTTACTGGAGCCAACAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

85

Amino Acids

9.41

Weight (kDa)

4.8

Isoelectric Point (pI)

32.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 150
AclWI GGATC 1 cut(s) 127
AcuI CTGAAG 1 cut(s) 42
AluBI AGCT 3 cut(s) 20, 46, 150
AluI AGCT 3 cut(s) 20, 46, 150
AlwI GGATC 1 cut(s) 127
AoxI GGCC 1 cut(s) 236
ApeKI GCWGC 1 cut(s) 80
AsuHPI GGTGA 1 cut(s) 149
BauI CACGAG 1 cut(s) 202
BbvI GCAGC 1 cut(s) 92
BccI CCATC 1 cut(s) 162
BfaI CTAG 3 cut(s) 17, 47, 191
BfuAI ACCTGC 1 cut(s) 150
BisI GCNGC 1 cut(s) 81
BlsI GCNGC 1 cut(s) 82
BmiI GGNNCC 1 cut(s) 248
Bse1I ACTGG 2 cut(s) 200, 248
BseNI ACTGG 2 cut(s) 200, 248
BseXI GCAGC 1 cut(s) 92
BshFI GGCC 1 cut(s) 238
BsnI GGCC 1 cut(s) 238
Bsp143I GATC 2 cut(s) 84, 132
BspANI GGCC 1 cut(s) 238
BspLI GGNNCC 1 cut(s) 248
BspMI ACCTGC 1 cut(s) 150
BspPI GGATC 1 cut(s) 127
BsrI ACTGG 2 cut(s) 200, 248
BssMI GATC 2 cut(s) 84, 132
BssSI CACGAG 1 cut(s) 202
Bst2BI CACGAG 1 cut(s) 202
Bst4CI ACNGT 2 cut(s) 37, 118
BstC8I GCNNGC 1 cut(s) 188
BstKTI GATC 2 cut(s) 87, 135
BstMBI GATC 2 cut(s) 84, 132
BstMWI GCNNNNNNNGC 3 cut(s) 17, 196, 205
BstNSI RCATGY 1 cut(s) 190
BstV1I GCAGC 1 cut(s) 92
BstXI CCANNNNNNTGG 1 cut(s) 172
BsuRI GGCC 1 cut(s) 238
BveI ACCTGC 1 cut(s) 150
Cac8I GCNNGC 1 cut(s) 188
CviAII CATG 3 cut(s) 103, 130, 187
CviJI RGCY 7 cut(s) 20, 46, 150, 199, 208, 238, 249
CviKI_1 RGCY 7 cut(s) 20, 46, 150, 199, 208, 238, 249
DpnI GATC 2 cut(s) 86, 134
DpnII GATC 2 cut(s) 84, 132
Eco147I AGGCCT 1 cut(s) 238
Eco57I CTGAAG 1 cut(s) 42
FaeI CATG 3 cut(s) 106, 133, 190
FaiI YATR 8 cut(s) 89, 91, 104, 122, 131, 147, 173, 188
FatI CATG 3 cut(s) 102, 129, 186
FauNDI CATATG 1 cut(s) 89
Fnu4HI GCNGC 1 cut(s) 81
Fsp4HI GCNGC 1 cut(s) 81
FspBI CTAG 3 cut(s) 17, 47, 191
GluI GCNGC 1 cut(s) 81
HaeIII GGCC 1 cut(s) 238
Hin1II CATG 3 cut(s) 106, 133, 190
HinfI GANTC 1 cut(s) 220
HphI GGTGA 1 cut(s) 149
Hpy188I TCNGA 1 cut(s) 61
Hpy188III TCNNGA 1 cut(s) 224
HpyCH4III ACNGT 2 cut(s) 37, 118
HpyCH4V TGCA 3 cut(s) 80, 102, 145
HpyF10VI GCNNNNNNNGC 3 cut(s) 17, 196, 205
Hsp92II CATG 3 cut(s) 106, 133, 190
Kzo9I GATC 2 cut(s) 84, 132
LmnI GCTCC 2 cut(s) 155, 246
LpnPI CCDG 4 cut(s) 155, 181, 229, 237
Lsp1109I GCAGC 1 cut(s) 92
MaeI CTAG 3 cut(s) 17, 47, 191
MalI GATC 2 cut(s) 86, 134
MboI GATC 2 cut(s) 84, 132
MnlI CCTC 2 cut(s) 99, 228
MslI CAYNNNNRTG 1 cut(s) 170
MwoI GCNNNNNNNGC 3 cut(s) 17, 196, 205
NdeI CATATG 1 cut(s) 89
NdeII GATC 2 cut(s) 84, 132
NlaIII CATG 3 cut(s) 106, 133, 190
NlaIV GGNNCC 1 cut(s) 248
NspI RCATGY 1 cut(s) 190
PaeI GCATGC 1 cut(s) 190
PceI AGGCCT 1 cut(s) 238
PcsI WCGNNNNNNNCGW 1 cut(s) 209
PfeI GAWTC 1 cut(s) 220
PkrI GCNGC 1 cut(s) 82
PspN4I GGNNCC 1 cut(s) 248
RseI CAYNNNNRTG 1 cut(s) 170
SatI GCNGC 1 cut(s) 81
Sau3AI GATC 2 cut(s) 84, 132
SetI ASST 5 cut(s) 18, 22, 48, 144, 152
SmiMI CAYNNNNRTG 1 cut(s) 170
SphI GCATGC 1 cut(s) 190
SseBI AGGCCT 1 cut(s) 238
SspMI CTAG 3 cut(s) 17, 47, 191
StuI AGGCCT 1 cut(s) 238
TaaI ACNGT 2 cut(s) 37, 118
TfiI GAWTC 1 cut(s) 220
TseI GCWGC 1 cut(s) 80
XceI RCATGY 1 cut(s) 190
XspI CTAG 3 cut(s) 17, 47, 191
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.