Rroxscaffold_3G00253350

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Reverse (-)
47376960 .. 47381079
4120 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00253350.1

Sequence Viewer

Length: 228 bp
ATGGGGTCAAGAAATGGGAAAAAAGCTTTTGTTATTGTGTTTTCACTTCAAGGCTCACACTTGGTGGCTCTCTATATTCTCGAAAGATTTCTAATTATAAGATCGATTGTCCCTTATCATGACCAAACCCTTCAAATAACAGAGATTGAAGATTGGCAATTGAAGGGAAAGATTGCTGGTGATGTGATGGCAATGTGGACAACAAGGACAATGCACAGGACGCGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

75

Amino Acids

8.72

Weight (kDa)

9.98

Isoelectric Point (pI)

46.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 98
AccII CGCG 1 cut(s) 223
AciI CCGC 1 cut(s) 223
AdeI CACNNNGTG 1 cut(s) 64
AgsI TTSAA 4 cut(s) 50, 134, 149, 163
AluBI AGCT 1 cut(s) 26
AluI AGCT 1 cut(s) 26
Asp700I GAANNNNTTC 1 cut(s) 87
AsuHPI GGTGA 1 cut(s) 191
BccI CCATC 1 cut(s) 181
Bsa29I ATCGAT 1 cut(s) 104
Bse3DI GCAATG 1 cut(s) 198
BseCI ATCGAT 1 cut(s) 104
BseMI GCAATG 1 cut(s) 198
Bsh1236I CGCG 1 cut(s) 223
BshVI ATCGAT 1 cut(s) 104
BslFI GGGAC 1 cut(s) 95
BsmFI GGGAC 1 cut(s) 95
Bsp143I GATC 1 cut(s) 101
BspACI CCGC 1 cut(s) 223
BspDI ATCGAT 1 cut(s) 104
BspFNI CGCG 1 cut(s) 223
BspHI TCATGA 1 cut(s) 118
BsrDI GCAATG 1 cut(s) 198
BssMI GATC 1 cut(s) 101
BstFNI CGCG 1 cut(s) 223
BstKTI GATC 1 cut(s) 104
BstMBI GATC 1 cut(s) 101
BstMWI GCNNNNNNNGC 1 cut(s) 220
BstUI CGCG 1 cut(s) 223
Bsu15I ATCGAT 1 cut(s) 104
BsuTUI ATCGAT 1 cut(s) 104
CciI TCATGA 1 cut(s) 118
ClaI ATCGAT 1 cut(s) 104
CviAII CATG 1 cut(s) 119
CviJI RGCY 3 cut(s) 26, 54, 68
CviKI_1 RGCY 3 cut(s) 26, 54, 68
DpnI GATC 1 cut(s) 103
DpnII GATC 1 cut(s) 101
DraIII CACNNNGTG 1 cut(s) 64
FaeI CATG 1 cut(s) 122
FaiI YATR 3 cut(s) 75, 98, 120
FaqI GGGAC 1 cut(s) 95
FatI CATG 1 cut(s) 118
Hin1II CATG 1 cut(s) 122
HindIII AAGCTT 1 cut(s) 24
HphI GGTGA 1 cut(s) 191
Hpy166II GTNNAC 1 cut(s) 198
Hpy188III TCNNGA 3 cut(s) 9, 80, 119
Hpy8I GTNNAC 1 cut(s) 198
HpyAV CCTTC 2 cut(s) 140, 157
HpyCH4V TGCA 1 cut(s) 214
HpyF10VI GCNNNNNNNGC 1 cut(s) 220
Hsp92II CATG 1 cut(s) 122
Kzo9I GATC 1 cut(s) 101
LpnPI CCDG 2 cut(s) 162, 202
MalI GATC 1 cut(s) 103
MboI GATC 1 cut(s) 101
MboII GAAGA 1 cut(s) 161
MfeI CAATTG 1 cut(s) 158
MluCI AATT 2 cut(s) 93, 158
MroXI GAANNNNTTC 1 cut(s) 87
MunI CAATTG 1 cut(s) 158
MvnI CGCG 1 cut(s) 223
MwoI GCNNNNNNNGC 1 cut(s) 220
NdeII GATC 1 cut(s) 101
NlaIII CATG 1 cut(s) 122
PagI TCATGA 1 cut(s) 118
PdmI GAANNNNTTC 1 cut(s) 87
PsiI TTATAA 1 cut(s) 98
Sau3AI GATC 1 cut(s) 101
SetI ASST 1 cut(s) 28
SgeI CNNG 7 cut(s) 21, 62, 73, 92, 131, 189, 216
Sse9I AATT 2 cut(s) 93, 158
SsiI CCGC 1 cut(s) 223
TaqI TCGA 2 cut(s) 81, 104
TasI AATT 2 cut(s) 93, 158
XmnI GAANNNNTTC 1 cut(s) 87
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.