Rroxscaffold_3G00254770

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Forward (+)
49084275 .. 49087743
3469 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00254770.1

Sequence Viewer

Length: 183 bp
ATGTTGATTGGTTCTGAGGAAAAGATTTATATACAGAGACATGCACATGGTGATAGACATTTTGTTCACAATGAAGAAAAAGAAGGTTACGGGTCAAGTGGTGGGATAGAAATGGATGATGATGTAGAAGAAGAATATCATGGTCATGGTGCACAAGAAAGAAATGGAAACAATAAGAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

60

Amino Acids

6.87

Weight (kDa)

5.19

Isoelectric Point (pI)

48.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AdeI CACNNNGTG 1 cut(s) 50
Alw21I GWGCWC 1 cut(s) 154
Alw26I GTCTC 1 cut(s) 31
Alw44I GTGCAC 1 cut(s) 150
ApaLI GTGCAC 1 cut(s) 150
AsuHPI GGTGA 1 cut(s) 62
BaeGI GKGCMC 1 cut(s) 154
Bbv12I GWGCWC 1 cut(s) 154
BcoDI GTCTC 1 cut(s) 31
BseGI GGATG 1 cut(s) 121
BseMII CTCAG 1 cut(s) 6
BseSI GKGCMC 1 cut(s) 154
BsiHKAI GWGCWC 1 cut(s) 154
BsmAI GTCTC 1 cut(s) 31
Bsp1286I GDGCHC 1 cut(s) 154
BspCNI CTCAG 1 cut(s) 7
BstDEI CTNAG 1 cut(s) 15
BstF5I GGATG 1 cut(s) 121
BstMAI GTCTC 1 cut(s) 31
BstNSI RCATGY 1 cut(s) 44
BstSLI GKGCMC 1 cut(s) 154
BtsCI GGATG 1 cut(s) 121
CviAII CATG 4 cut(s) 41, 47, 140, 146
DdeI CTNAG 1 cut(s) 15
DraIII CACNNNGTG 1 cut(s) 50
FaeI CATG 4 cut(s) 44, 50, 143, 149
FaiI YATR 6 cut(s) 30, 32, 42, 48, 141, 147
FatI CATG 4 cut(s) 40, 46, 139, 145
FokI GGATG 1 cut(s) 128
Hin1II CATG 4 cut(s) 44, 50, 143, 149
HphI GGTGA 1 cut(s) 62
Hpy166II GTNNAC 2 cut(s) 67, 152
Hpy188I TCNGA 1 cut(s) 16
Hpy8I GTNNAC 2 cut(s) 67, 152
HpyAV CCTTC 1 cut(s) 77
HpyCH4V TGCA 2 cut(s) 44, 152
HpyF3I CTNAG 1 cut(s) 15
Hsp92II CATG 4 cut(s) 44, 50, 143, 149
MaeIII GTNAC 1 cut(s) 86
MboII GAAGA 3 cut(s) 86, 140, 143
MhlI GDGCHC 1 cut(s) 154
MnlI CCTC 1 cut(s) 10
MslI CAYNNNNRTG 2 cut(s) 45, 144
NlaIII CATG 4 cut(s) 44, 50, 143, 149
NspI RCATGY 1 cut(s) 44
RseI CAYNNNNRTG 2 cut(s) 45, 144
SduI GDGCHC 1 cut(s) 154
SetI ASST 1 cut(s) 88
SgeI CNNG 7 cut(s) 53, 59, 103, 108, 152, 158, 167
SmiMI CAYNNNNRTG 2 cut(s) 45, 144
TspDTI ATGAA 1 cut(s) 87
VneI GTGCAC 1 cut(s) 150
XceI RCATGY 1 cut(s) 44
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.