Rroxscaffold_5G00386540

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
OG0018839
Physical Location & Seq
Forward (+)
65424141 .. 65425090
950 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00386540.1

Sequence Viewer

Length: 264 bp
ATGAGAGGTGTTCCTTCTCTCTTTAGGAGAAGGGTTTGCAATGAAGCAATCCAGTCCGTCCTCCAATTACTAATTAATTGGACCTTCAAGGGAGTACAAAAACGAAAGATTCGAGTAACCCTCGAATATAAAAAAGGGCCTGATGGGAAAGACGGGAAGCATTCTTCAACACTGAAGTACCTAGGTGCTTGGGAGAAGCAACTCTATTACCTCGTGGAGAAAGTACTCGAAGAGGAGAAAATAGGGGTGGAGTCCTTGAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

87

Amino Acids

10.15

Weight (kDa)

9.79

Isoelectric Point (pI)

39.41

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF632 PF04782 17 - 73 6e-06 Protein of unknown function (DUF632)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018839)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g36400 FvH4_4g36610 FvH4_4g36631
prunus_persica Prupe.5G138800_v2.0.a1
rosa_laevigata RLG00000005688
rosa_roxburghii Rroxscaffold_5G00386540
rosa_samantha Rh4AG429900 Rh4BG439300 Rh4CG456600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 194
AfaI GTAC 3 cut(s) 96, 179, 225
AgsI TTSAA 3 cut(s) 88, 168, 259
AoxI GGCC 1 cut(s) 137
AseI ATTAAT 1 cut(s) 75
AspA2I CCTAGG 1 cut(s) 181
AspS9I GGNCC 2 cut(s) 81, 137
AvaII GGWCC 1 cut(s) 81
AvrII CCTAGG 1 cut(s) 181
BaeI ACNNNNGTAYC 2 cut(s) 161, 194
BauI CACGAG 1 cut(s) 212
BccI CCATC 1 cut(s) 137
BfaI CTAG 1 cut(s) 182
BlnI CCTAGG 1 cut(s) 181
BmcAI AGTACT 1 cut(s) 225
Bme18I GGWCC 1 cut(s) 81
BmgT120I GGNCC 2 cut(s) 81, 137
BplI GAGNNNNNCTC 2 cut(s) 105, 137
BsaJI CCNNGG 1 cut(s) 181
Bse1I ACTGG 1 cut(s) 52
Bse3DI GCAATG 1 cut(s) 46
BseDI CCNNGG 1 cut(s) 181
BseMI GCAATG 1 cut(s) 46
BseNI ACTGG 1 cut(s) 52
BseRI GAGGAG 1 cut(s) 248
BshFI GGCC 1 cut(s) 139
BsmI GAATGC 1 cut(s) 160
BsnI GGCC 1 cut(s) 139
BspANI GGCC 1 cut(s) 139
BsrDI GCAATG 1 cut(s) 46
BsrI ACTGG 1 cut(s) 52
BssECI CCNNGG 1 cut(s) 181
BssSI CACGAG 1 cut(s) 212
BssT1I CCWWGG 1 cut(s) 181
Bst2BI CACGAG 1 cut(s) 212
Bst6I CTCTTC 1 cut(s) 225
BsuRI GGCC 1 cut(s) 139
BtsIMutI CAGTG 1 cut(s) 170
Cfr13I GGNCC 2 cut(s) 81, 137
Csp6I GTAC 3 cut(s) 95, 178, 224
CviJI RGCY 1 cut(s) 139
CviKI_1 RGCY 1 cut(s) 139
CviQI GTAC 3 cut(s) 95, 178, 224
Eam1104I CTCTTC 1 cut(s) 225
EarI CTCTTC 1 cut(s) 225
Eco130I CCWWGG 1 cut(s) 181
Eco47I GGWCC 1 cut(s) 81
Eco57I CTGAAG 1 cut(s) 194
EcoO109I RGGNCCY 1 cut(s) 137
EcoT14I CCWWGG 1 cut(s) 181
ErhI CCWWGG 1 cut(s) 181
FaiI YATR 1 cut(s) 129
FspBI CTAG 1 cut(s) 182
HaeIII GGCC 1 cut(s) 139
HinfI GANTC 2 cut(s) 109, 251
HpyAV CCTTC 3 cut(s) 24, 24, 94
HpyCH4V TGCA 1 cut(s) 39
LpnPI CCDG 2 cut(s) 65, 153
MaeI CTAG 1 cut(s) 182
MaeIII GTNAC 1 cut(s) 115
MboII GAAGA 2 cut(s) 156, 242
MluCI AATT 3 cut(s) 65, 72, 76
MlyI GAGTC 1 cut(s) 260
MnlI CCTC 4 cut(s) 71, 131, 221, 226
MseI TTAA 1 cut(s) 75
Mva1269I GAATGC 1 cut(s) 160
PcsI WCGNNNNNNNCGW 1 cut(s) 109
PctI GAATGC 1 cut(s) 160
PfeI GAWTC 1 cut(s) 109
PleI GAGTC 1 cut(s) 259
PpsI GAGTC 1 cut(s) 259
PshBI ATTAAT 1 cut(s) 75
PspPI GGNCC 2 cut(s) 81, 137
RsaI GTAC 3 cut(s) 96, 179, 225
RsaNI GTAC 3 cut(s) 95, 178, 224
SaqAI TTAA 1 cut(s) 75
Sau96I GGNCC 2 cut(s) 81, 137
ScaI AGTACT 1 cut(s) 225
SchI GAGTC 1 cut(s) 260
SetI ASST 5 cut(s) 10, 86, 183, 187, 213
SinI GGWCC 1 cut(s) 81
Sse9I AATT 3 cut(s) 65, 72, 76
SspMI CTAG 1 cut(s) 182
StyI CCWWGG 1 cut(s) 181
TaqI TCGA 3 cut(s) 112, 123, 228
TasI AATT 3 cut(s) 65, 72, 76
TatI WGTACW 2 cut(s) 94, 223
TfiI GAWTC 1 cut(s) 109
Tru1I TTAA 1 cut(s) 75
Tru9I TTAA 1 cut(s) 75
TscAI CASTG 1 cut(s) 177
TspDTI ATGAA 1 cut(s) 57
TspGWI ACGGA 1 cut(s) 46
TspRI CASTG 1 cut(s) 177
VpaK11BI GGWCC 1 cut(s) 81
VspI ATTAAT 1 cut(s) 75
XmaJI CCTAGG 1 cut(s) 181
XspI CTAG 1 cut(s) 182
ZrmI AGTACT 1 cut(s) 225
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.