Rroxscaffold_7G00157250

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
OG0015553
Physical Location & Seq
Reverse (-)
1009266 .. 1011023
1758 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00157250.1

Sequence Viewer

Length: 672 bp
ATGGCAATGGCCATATGGGTTCTTTTGGTTTCTCTTCTTGTTGTCTCTGTTTCTGCTGCTACTCAAATGAAAGTTACTAATAACCCTGCGGATGAGTTAGTGGCTGTTCTTAACGCTAACAGAACCGCACACAAATCATCTTCCCTCTATGACAACCCTGGATTGGCCTGCATTGCCTTGCAGTACATAAAAGCGTACAAAGGTGACTGCGGTGCTGTAGGAGGTCCAGATGCCAAGAAGCCAGCTGATTCCGAGTTTGTTAAAGTTTTTGCTCCAAACTGTGGTATCCAAGTCTCAACCCTCTCTCCAATTACTGGTCGTTTACTTGGCTGCGAGACTAAATATGTCCACGCTGCCAAAGCGTTTTCAAACATCTTGATTGAAAGCAGTAAGAGCTTGGACATTCTCTACAATAAGACCCACACTGAAGTTGGAGCTGCTGTGAGTGGCAGTGATGGTGGTTCTCCATATTTCTGGTGTGTGTTGTTCAGCGGCGGCAAAACTAACAGCAGTTTTGTTGCCGAGGGAGGTGTGGTTAAGATAACAAGACCTGGGTGCTTTAGTGGTGCAGATGACGAGTGCAGTGGCGCTTATGATTGGTCTAGAAGTAGTAGTGTGTGGGCATTTTTCACCACAGCTCTGATTGCAATGGGGTTTGCCTTTGGACTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

223

Amino Acids

23.37

Weight (kDa)

6.8

Isoelectric Point (pI)

34.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015553)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g30950
malus_domestica MD08G1071500.v1.1 MD13G1011100.v1.1 MD15G1049700.v1.1
prunus_persica Prupe.1G404000_v2.0.a1
pyrus_communis pycom08g05940 pycom15g04840
rosa_chinensis RchiOBHm_Chr6g0311891
rosa_laevigata RLG00000010371
rosa_multiflora Rmu_sc0002888.1_g000053
rosa_roxburghii Rroxscaffold_7G00157250
rosa_rugosa Rorug06G0391200
rosa_samantha Rh6BG518700 Rh6CG524400 Rh6DG510000
rosa_wichuraiana Rw6G044170

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 281, 314
AciI CCGC 5 cut(s) 89, 126, 210, 492, 495
AcoI YGGCCR 1 cut(s) 9
AcuI CTGAAG 1 cut(s) 447
AfaI GTAC 2 cut(s) 185, 197
AfiI CCNNNNNNNGG 3 cut(s) 163, 281, 314
AgsI TTSAA 2 cut(s) 369, 383
AjnI CCWGG 2 cut(s) 157, 550
AluBI AGCT 4 cut(s) 245, 396, 437, 638
AluI AGCT 4 cut(s) 245, 396, 437, 638
Alw26I GTCTC 3 cut(s) 49, 298, 329
AoxI GGCC 2 cut(s) 9, 165
ApeKI GCWGC 4 cut(s) 56, 330, 353, 437
AspLEI GCGC 1 cut(s) 590
AspS9I GGNCC 1 cut(s) 224
AsuHPI GGTGA 2 cut(s) 215, 622
AvaII GGWCC 1 cut(s) 224
BaeI ACNNNNGTAYC 2 cut(s) 268, 301
BalI TGGCCA 1 cut(s) 11
BbvI GCAGC 4 cut(s) 43, 317, 340, 424
BccI CCATC 1 cut(s) 449
BciT130I CCWGG 2 cut(s) 159, 552
BciVI GTATCC 1 cut(s) 296
BcoDI GTCTC 3 cut(s) 49, 298, 329
BfaI CTAG 1 cut(s) 603
BfmI CTRYAG 1 cut(s) 216
BfoI RGCGCY 1 cut(s) 591
BfuI GTATCC 1 cut(s) 296
BisI GCNGC 6 cut(s) 57, 331, 354, 438, 493, 496
BlsI GCNGC 6 cut(s) 58, 332, 355, 439, 494, 497
Bme1390I CCNGG 2 cut(s) 159, 552
Bme18I GGWCC 1 cut(s) 224
BmgT120I GGNCC 1 cut(s) 224
BmrFI CCNGG 2 cut(s) 159, 552
BmsI GCATC 1 cut(s) 220
BsaJI CCNNGG 3 cut(s) 157, 522, 551
BsaXI ACNNNNNCTCC 6 cut(s) 289, 319, 426, 456, 519, 549
Bsc4I CCNNNNNNNGG 3 cut(s) 163, 281, 314
Bse1I ACTGG 1 cut(s) 319
Bse3DI GCAATG 3 cut(s) 12, 171, 654
BseBI CCWGG 2 cut(s) 159, 552
BseDI CCNNGG 3 cut(s) 157, 522, 551
BseGI GGATG 1 cut(s) 97
BseLI CCNNNNNNNGG 3 cut(s) 163, 281, 314
BseMI GCAATG 3 cut(s) 12, 171, 654
BseNI ACTGG 1 cut(s) 319
BseXI GCAGC 4 cut(s) 43, 317, 340, 424
BsgI GTGCAG 2 cut(s) 588, 601
BshFI GGCC 2 cut(s) 11, 167
BslI CCNNNNNNNGG 3 cut(s) 163, 281, 314
BsmAI GTCTC 3 cut(s) 49, 298, 329
BsnI GGCC 2 cut(s) 11, 167
BspACI CCGC 5 cut(s) 89, 126, 210, 492, 495
BspANI GGCC 2 cut(s) 11, 167
BsrDI GCAATG 3 cut(s) 12, 171, 654
BsrI ACTGG 1 cut(s) 319
BssECI CCNNGG 3 cut(s) 157, 522, 551
Bst2UI CCWGG 2 cut(s) 159, 552
Bst4CI ACNGT 1 cut(s) 281
Bst6I CTCTTC 1 cut(s) 39
BstC8I GCNNGC 2 cut(s) 169, 243
BstF5I GGATG 1 cut(s) 97
BstH2I RGCGCY 1 cut(s) 591
BstHHI GCGC 1 cut(s) 590
BstMAI GTCTC 3 cut(s) 49, 298, 329
BstMWI GCNNNNNNNGC 4 cut(s) 173, 359, 393, 644
BstNI CCWGG 2 cut(s) 159, 552
BstSCI CCNGG 2 cut(s) 157, 550
BstSFI CTRYAG 1 cut(s) 216
BstV1I GCAGC 4 cut(s) 43, 317, 340, 424
BstXI CCANNNNNNTGG 1 cut(s) 474
BsuI GTATCC 1 cut(s) 296
BsuRI GGCC 2 cut(s) 11, 167
BtsCI GGATG 1 cut(s) 97
BtsI GCAGTG 2 cut(s) 457, 589
BtsIMutI CAGTG 3 cut(s) 423, 457, 589
Cac8I GCNNGC 2 cut(s) 169, 243
CfoI GCGC 1 cut(s) 590
Cfr13I GGNCC 1 cut(s) 224
Csp6I GTAC 2 cut(s) 184, 196
CviJI RGCY 9 cut(s) 11, 104, 167, 241, 245, 330, 396, 437, 638
CviKI_1 RGCY 9 cut(s) 11, 104, 167, 241, 245, 330, 396, 437, 638
CviQI GTAC 2 cut(s) 184, 196
EaeI YGGCCR 1 cut(s) 9
Eam1104I CTCTTC 1 cut(s) 39
EarI CTCTTC 1 cut(s) 39
Eco47I GGWCC 1 cut(s) 224
Eco57I CTGAAG 1 cut(s) 447
EcoRII CCWGG 2 cut(s) 157, 550
FaiI YATR 8 cut(s) 14, 16, 150, 188, 345, 469, 594, 670
FauNDI CATATG 1 cut(s) 14
Fnu4HI GCNGC 6 cut(s) 57, 331, 354, 438, 493, 496
FokI GGATG 1 cut(s) 104
Fsp4HI GCNGC 6 cut(s) 57, 331, 354, 438, 493, 496
FspBI CTAG 1 cut(s) 603
GlaI GCGC 1 cut(s) 589
GluI GCNGC 6 cut(s) 57, 331, 354, 438, 493, 496
HaeII RGCGCY 1 cut(s) 591
HaeIII GGCC 2 cut(s) 11, 167
HhaI GCGC 1 cut(s) 590
Hin6I GCGC 1 cut(s) 588
HinP1I GCGC 1 cut(s) 588
HinfI GANTC 1 cut(s) 248
HphI GGTGA 2 cut(s) 215, 622
Hpy166II GTNNAC 2 cut(s) 323, 349
Hpy188I TCNGA 2 cut(s) 253, 642
Hpy188III TCNNGA 3 cut(s) 227, 376, 603
Hpy8I GTNNAC 2 cut(s) 323, 349
HpyCH4III ACNGT 1 cut(s) 281
HpyCH4V TGCA 5 cut(s) 171, 181, 569, 582, 647
HpyF10VI GCNNNNNNNGC 4 cut(s) 173, 359, 393, 644
HspAI GCGC 1 cut(s) 588
LmnI GCTCC 2 cut(s) 277, 434
Lsp1109I GCAGC 4 cut(s) 43, 317, 340, 424
LweI GCATC 1 cut(s) 220
MaeI CTAG 1 cut(s) 603
MaeIII GTNAC 2 cut(s) 73, 203
MboII GAAGA 2 cut(s) 26, 132
MlsI TGGCCA 1 cut(s) 11
MluCI AATT 1 cut(s) 309
MluNI TGGCCA 1 cut(s) 11
MmeI TCCRAC 1 cut(s) 412
MnlI CCTC 5 cut(s) 155, 215, 311, 517, 521
Mox20I TGGCCA 1 cut(s) 11
MscI TGGCCA 1 cut(s) 11
MseI TTAA 3 cut(s) 111, 261, 537
Msp20I TGGCCA 1 cut(s) 11
MspA1I CMGCKG 2 cut(s) 245, 492
MspR9I CCNGG 2 cut(s) 159, 552
MvaI CCWGG 2 cut(s) 159, 552
MwoI GCNNNNNNNGC 4 cut(s) 173, 359, 393, 644
NdeI CATATG 1 cut(s) 14
NmeAIII GCCGAG 1 cut(s) 547
NmuCI GTSAC 1 cut(s) 203
PfeI GAWTC 1 cut(s) 248
PflMI CCANNNNNTGG 2 cut(s) 281, 314
PkrI GCNGC 6 cut(s) 58, 332, 355, 439, 494, 497
Psp6I CCWGG 2 cut(s) 157, 550
PspGI CCWGG 2 cut(s) 157, 550
PspPI GGNCC 1 cut(s) 224
PvuII CAGCTG 1 cut(s) 245
RsaI GTAC 2 cut(s) 185, 197
RsaNI GTAC 2 cut(s) 184, 196
SaqAI TTAA 3 cut(s) 111, 261, 537
SatI GCNGC 6 cut(s) 57, 331, 354, 438, 493, 496
Sau96I GGNCC 1 cut(s) 224
ScrFI CCNGG 2 cut(s) 159, 552
SetI ASST 8 cut(s) 205, 226, 247, 398, 439, 532, 553, 640
SfaNI GCATC 1 cut(s) 220
SfcI CTRYAG 1 cut(s) 216
SinI GGWCC 1 cut(s) 224
Sse9I AATT 1 cut(s) 309
SsiI CCGC 5 cut(s) 89, 126, 210, 492, 495
SspMI CTAG 1 cut(s) 603
StyD4I CCNGG 2 cut(s) 157, 550
TaaI ACNGT 1 cut(s) 281
TasI AATT 1 cut(s) 309
TatI WGTACW 1 cut(s) 183
TauI GCSGC 2 cut(s) 495, 498
TfiI GAWTC 1 cut(s) 248
Tru1I TTAA 3 cut(s) 111, 261, 537
Tru9I TTAA 3 cut(s) 111, 261, 537
TscAI CASTG 3 cut(s) 430, 457, 589
TseFI GTSAC 1 cut(s) 203
TseI GCWGC 4 cut(s) 56, 330, 353, 437
Tsp45I GTSAC 1 cut(s) 203
TspDTI ATGAA 1 cut(s) 83
TspRI CASTG 3 cut(s) 430, 457, 589
Van91I CCANNNNNTGG 2 cut(s) 281, 314
VpaK11BI GGWCC 1 cut(s) 224
XbaI TCTAGA 1 cut(s) 602
XcmI CCANNNNNNNNNTGG 1 cut(s) 428
XspI CTAG 1 cut(s) 603
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.