Rroxscaffold_7G00181030

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Reverse (-)
20300354 .. 20311378
11025 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00181030.1

Sequence Viewer

Length: 159 bp
ATGAAGATGCGGCGGTGTAGTGTTGTGCAGGTTCTTTGTTTGCTTGCCATGAATATGGATATCGTAAGAGATGAAGGAAATTTTGTTAGTGTTAAATCAAGCCATGCTTCAGTTTTTGTATCAAAGATAACAACTTTTTGTGAATTGATGAAGACTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

52

Amino Acids

5.89

Weight (kDa)

9.06

Isoelectric Point (pI)

25.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 19
AciI CCGC 2 cut(s) 10, 13
AcsI RAATTY 1 cut(s) 79
AcuI CTGAAG 1 cut(s) 93
ApoI RAATTY 1 cut(s) 79
BfuAI ACCTGC 1 cut(s) 19
BisI GCNGC 1 cut(s) 11
BlsI GCNGC 1 cut(s) 12
BsgI GTGCAG 1 cut(s) 47
BspACI CCGC 2 cut(s) 10, 13
BspMI ACCTGC 1 cut(s) 19
BstC8I GCNNGC 1 cut(s) 45
BstXI CCANNNNNNTGG 1 cut(s) 55
BveI ACCTGC 1 cut(s) 19
Cac8I GCNNGC 1 cut(s) 45
CviAII CATG 2 cut(s) 49, 104
CviJI RGCY 1 cut(s) 102
CviKI_1 RGCY 1 cut(s) 102
Eco32I GATATC 1 cut(s) 61
Eco57I CTGAAG 1 cut(s) 93
EcoRV GATATC 1 cut(s) 61
FaeI CATG 2 cut(s) 52, 107
FaiI YATR 3 cut(s) 50, 56, 105
FalI AAGNNNNNCTT 2 cut(s) 91, 123
FatI CATG 2 cut(s) 48, 103
Fnu4HI GCNGC 1 cut(s) 11
Fsp4HI GCNGC 1 cut(s) 11
FspEI CC 5 cut(s) 14, 41, 60, 61, 116
GluI GCNGC 1 cut(s) 11
Hin1II CATG 2 cut(s) 52, 107
HpyAV CCTTC 1 cut(s) 68
HpyCH4V TGCA 1 cut(s) 28
Hsp92II CATG 2 cut(s) 52, 107
LpnPI CCDG 1 cut(s) 14
MboII GAAGA 1 cut(s) 16
MluCI AATT 2 cut(s) 79, 143
MseI TTAA 1 cut(s) 93
MslI CAYNNNNRTG 1 cut(s) 53
NlaIII CATG 2 cut(s) 52, 107
PkrI GCNGC 1 cut(s) 12
RseI CAYNNNNRTG 1 cut(s) 53
SaqAI TTAA 1 cut(s) 93
SatI GCNGC 1 cut(s) 11
SetI ASST 1 cut(s) 33
SgeI CNNG 5 cut(s) 41, 56, 61, 111, 116
SmiMI CAYNNNNRTG 1 cut(s) 53
Sse9I AATT 2 cut(s) 79, 143
SsiI CCGC 2 cut(s) 10, 13
TasI AATT 2 cut(s) 79, 143
TauI GCSGC 1 cut(s) 13
Tru1I TTAA 1 cut(s) 93
Tru9I TTAA 1 cut(s) 93
TspDTI ATGAA 3 cut(s) 17, 65, 87
XapI RAATTY 1 cut(s) 79
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.