Rh5BG462500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Reverse (-)
73961669 .. 73974436
12768 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG462500.1

Sequence Viewer

Length: 201 bp
ATGACTCTGCCGGGTCACCCGATGGTTCTTCCTCAGAAAATCCACCACCCCAAAACGGATACCACCGCCTTTGCCCGCCTTCATCTCCACCATGCAACCTTGCAGGTGCTTTTTGTCGAGAGGGTCATCTTGGCTCATCAATCAGGATTAGAAGCTTCCCAACCTGCTCTAAATCAAATCGGGTGCTTGGTCCTACGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

66

Amino Acids

7.33

Weight (kDa)

9.3

Isoelectric Point (pI)

39.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 94
Acc36I ACCTGC 2 cut(s) 94, 172
AciI CCGC 2 cut(s) 66, 76
AfiI CCNNNNNNNGG 1 cut(s) 55
AluBI AGCT 1 cut(s) 155
AluI AGCT 1 cut(s) 155
AspS9I GGNCC 1 cut(s) 190
AsuC2I CCSGG 1 cut(s) 12
AsuHPI GGTGA 1 cut(s) 8
AvaII GGWCC 1 cut(s) 190
BccI CCATC 1 cut(s) 16
BciVI GTATCC 1 cut(s) 52
BcnI CCSGG 1 cut(s) 12
BfuAI ACCTGC 2 cut(s) 94, 172
BfuI GTATCC 1 cut(s) 52
Bme1390I CCNGG 1 cut(s) 12
Bme18I GGWCC 1 cut(s) 190
BmgT120I GGNCC 1 cut(s) 190
BmrFI CCNGG 1 cut(s) 12
BpuMI CCSGG 1 cut(s) 12
Bsc4I CCNNNNNNNGG 1 cut(s) 55
BseLI CCNNNNNNNGG 1 cut(s) 55
BseMII CTCAG 1 cut(s) 47
BsiSI CCGG 1 cut(s) 11
BslI CCNNNNNNNGG 1 cut(s) 55
BspACI CCGC 2 cut(s) 66, 76
BspCNI CTCAG 1 cut(s) 46
BspMI ACCTGC 2 cut(s) 94, 172
BstC8I GCNNGC 1 cut(s) 76
BstDEI CTNAG 1 cut(s) 33
BstEII GGTNACC 1 cut(s) 14
BstPI GGTNACC 1 cut(s) 14
BstSCI CCNGG 1 cut(s) 10
BsuI GTATCC 1 cut(s) 52
BveI ACCTGC 2 cut(s) 94, 172
Cac8I GCNNGC 1 cut(s) 76
Cfr13I GGNCC 1 cut(s) 190
CspCI CAANNNNNGTGG 2 cut(s) 52, 87
CviAII CATG 1 cut(s) 92
CviJI RGCY 2 cut(s) 134, 155
CviKI_1 RGCY 2 cut(s) 134, 155
DdeI CTNAG 1 cut(s) 33
Eco47I GGWCC 1 cut(s) 190
Eco91I GGTNACC 1 cut(s) 14
EcoO65I GGTNACC 1 cut(s) 14
FaeI CATG 1 cut(s) 95
FaiI YATR 1 cut(s) 93
FatI CATG 1 cut(s) 91
FauI CCCGC 1 cut(s) 83
HapII CCGG 1 cut(s) 11
Hin1II CATG 1 cut(s) 95
HindIII AAGCTT 1 cut(s) 153
HinfI GANTC 1 cut(s) 4
HpaII CCGG 1 cut(s) 11
HphI GGTGA 1 cut(s) 8
Hpy188I TCNGA 1 cut(s) 36
Hpy188III TCNNGA 2 cut(s) 118, 144
HpyAV CCTTC 1 cut(s) 89
HpyCH4V TGCA 2 cut(s) 95, 103
HpyF3I CTNAG 1 cut(s) 33
Hsp92II CATG 1 cut(s) 95
LpnPI CCDG 4 cut(s) 24, 89, 129, 177
MaeIII GTNAC 1 cut(s) 14
MboII GAAGA 1 cut(s) 20
MnlI CCTC 2 cut(s) 42, 114
MspI CCGG 1 cut(s) 11
MspR9I CCNGG 1 cut(s) 12
NciI CCSGG 1 cut(s) 12
NlaIII CATG 1 cut(s) 95
NmuCI GTSAC 1 cut(s) 14
PaqCI CACCTGC 1 cut(s) 94
PspEI GGTNACC 1 cut(s) 14
PspPI GGNCC 1 cut(s) 190
Sau96I GGNCC 1 cut(s) 190
ScrFI CCNGG 1 cut(s) 12
SetI ASST 4 cut(s) 101, 108, 157, 166
SinI GGWCC 1 cut(s) 190
SsiI CCGC 2 cut(s) 66, 76
StyD4I CCNGG 1 cut(s) 10
TaqI TCGA 1 cut(s) 117
TseFI GTSAC 1 cut(s) 14
Tsp45I GTSAC 1 cut(s) 14
TspDTI ATGAA 1 cut(s) 71
TspGWI ACGGA 1 cut(s) 71
VpaK11BI GGWCC 1 cut(s) 190
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.