Rorug01G0168200

Plant organelle RNA recognition domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
OG0016659
Physical Location & Seq
Forward (+)
22986535 .. 22989346
2812 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0168200.1

Sequence Viewer

Length: 333 bp
ATGGAATTCTCTGGACTTGATATCGGATGGGGTCAGAGGATACCTTTAGAGTTTGATGACAAACAGGGTTCATGGATTCTTAAGAGGGAATTACCGGAAGGACGATATGAATATAAGTACATTATTGATGGTGAATGGACACACAATAAAAATGAGCTTTTCACCTCTCCAAACAAGGATGGTCATGTCAACATTTATGTTCAGATTGTTGAGGATGATCCTAACAGTGCTAATGCCATCATAAGGAAGAAATTGACGGCTGATGATCCTGATCTAACAACAGACGAAAGACTTAAAATCAGACAGTTTCTTGAAGCTTATCTCATTCAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PORR

Protein Analysis

110

Amino Acids

12.93

Weight (kDa)

4.76

Isoelectric Point (pI)

27.53

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AMPK1_CBM PF16561 5 - 73 1.3e-13 Glycogen recognition site of AMP-activated protein kinase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016659)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G39120
fragaria_vesca FvH4_7g08660
malus_domestica MD01G1105000.v1.1
prunus_persica Prupe.2G210300_v2.0.a1
rosa_chinensis RchiOBHm_Chr1g0343651
rosa_laevigata RLG00000028956
rosa_multiflora Rmu_sc0000021.1_g000005 Rmu_sc0007600.1_g000003
rosa_roxburghii Rroxscaffold_4G00310400
rosa_rugosa Rorug01G0168100 Rorug01G0168200
rosa_samantha Rh1AG184100 Rh1CG171000
rosa_wichuraiana Rw1G015260

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 212, 260
AcsI RAATTY 1 cut(s) 5
AfaI GTAC 1 cut(s) 119
AfiI CCNNNNNNNGG 1 cut(s) 243
AflII CTTAAG 1 cut(s) 80
AgsI TTSAA 2 cut(s) 314, 329
AluBI AGCT 2 cut(s) 157, 317
AluI AGCT 2 cut(s) 157, 317
AlwI GGATC 2 cut(s) 212, 260
ApoI RAATTY 1 cut(s) 5
AsuHPI GGTGA 2 cut(s) 143, 154
BccI CCATC 4 cut(s) 21, 122, 173, 245
BceAI ACGGC 1 cut(s) 273
BciVI GTATCC 1 cut(s) 33
BfrI CTTAAG 1 cut(s) 80
BfuI GTATCC 1 cut(s) 33
BsaBI GATNNNNATC 1 cut(s) 270
BsaWI WCCGGW 1 cut(s) 94
Bsc4I CCNNNNNNNGG 1 cut(s) 243
Bse8I GATNNNNATC 1 cut(s) 270
BseGI GGATG 3 cut(s) 32, 184, 220
BseJI GATNNNNATC 1 cut(s) 270
BseLI CCNNNNNNNGG 1 cut(s) 243
BsiSI CCGG 1 cut(s) 95
BslI CCNNNNNNNGG 1 cut(s) 243
Bsp143I GATC 3 cut(s) 217, 265, 271
BspPI GGATC 2 cut(s) 212, 260
BspTI CTTAAG 1 cut(s) 80
BssMI GATC 3 cut(s) 217, 265, 271
Bst4CI ACNGT 2 cut(s) 227, 306
BstAFI CTTAAG 1 cut(s) 80
BstF5I GGATG 3 cut(s) 32, 184, 220
BstKTI GATC 3 cut(s) 220, 268, 274
BstMBI GATC 3 cut(s) 217, 265, 271
BsuI GTATCC 1 cut(s) 33
BtsCI GGATG 3 cut(s) 32, 184, 220
BtsIMutI CAGTG 1 cut(s) 232
Csp6I GTAC 1 cut(s) 118
CviAII CATG 2 cut(s) 72, 185
CviJI RGCY 3 cut(s) 157, 260, 317
CviKI_1 RGCY 3 cut(s) 157, 260, 317
CviQI GTAC 1 cut(s) 118
DpnI GATC 3 cut(s) 219, 267, 273
DpnII GATC 3 cut(s) 217, 265, 271
Eco32I GATATC 1 cut(s) 22
EcoRI GAATTC 1 cut(s) 5
EcoRV GATATC 1 cut(s) 22
FaeI CATG 2 cut(s) 75, 188
FaiI YATR 6 cut(s) 73, 108, 114, 186, 198, 242
FatI CATG 2 cut(s) 71, 184
FokI GGATG 3 cut(s) 39, 191, 227
HapII CCGG 1 cut(s) 95
Hin1II CATG 2 cut(s) 75, 188
HincII GTYRAC 1 cut(s) 190
HindII GTYRAC 1 cut(s) 190
HindIII AAGCTT 1 cut(s) 315
HinfI GANTC 1 cut(s) 76
HpaII CCGG 1 cut(s) 95
HphI GGTGA 2 cut(s) 143, 154
Hpy166II GTNNAC 1 cut(s) 190
Hpy188I TCNGA 4 cut(s) 26, 36, 204, 302
Hpy188III TCNNGA 3 cut(s) 12, 269, 311
Hpy8I GTNNAC 1 cut(s) 190
HpyAV CCTTC 1 cut(s) 92
HpyCH4III ACNGT 2 cut(s) 227, 306
Hsp92II CATG 2 cut(s) 75, 188
Kzo9I GATC 3 cut(s) 217, 265, 271
LpnPI CCDG 3 cut(s) 50, 108, 282
MalI GATC 3 cut(s) 219, 267, 273
MboI GATC 3 cut(s) 217, 265, 271
MboII GAAGA 1 cut(s) 259
MluCI AATT 3 cut(s) 5, 89, 251
MnlI CCTC 4 cut(s) 30, 78, 175, 205
MseI TTAA 2 cut(s) 81, 294
MspCI CTTAAG 1 cut(s) 80
MspI CCGG 1 cut(s) 95
NdeII GATC 3 cut(s) 217, 265, 271
NlaIII CATG 2 cut(s) 75, 188
PfeI GAWTC 1 cut(s) 76
RsaI GTAC 1 cut(s) 119
RsaNI GTAC 1 cut(s) 118
SaqAI TTAA 2 cut(s) 81, 294
Sau3AI GATC 3 cut(s) 217, 265, 271
SetI ASST 4 cut(s) 46, 159, 167, 319
SgeI CNNG 9 cut(s) 24, 29, 77, 84, 107, 187, 197, 281, 323
SmlI CTYRAG 1 cut(s) 80
SmoI CTYRAG 1 cut(s) 80
Sse9I AATT 3 cut(s) 5, 89, 251
TaaI ACNGT 2 cut(s) 227, 306
TasI AATT 3 cut(s) 5, 89, 251
TatI WGTACW 1 cut(s) 117
TfiI GAWTC 1 cut(s) 76
Tru1I TTAA 2 cut(s) 81, 294
Tru9I TTAA 2 cut(s) 81, 294
TscAI CASTG 1 cut(s) 232
TspDTI ATGAA 2 cut(s) 60, 123
TspRI CASTG 1 cut(s) 232
Vha464I CTTAAG 1 cut(s) 80
XapI RAATTY 1 cut(s) 5
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.