Rorug01G0452200

Methylenetetrahydrofolate reductase

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
Physical Location & Seq
Reverse (-)
54696658 .. 54696873
216 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0452200.1

Sequence Viewer

Length: 216 bp
ATGGATTTACAAGAAATTGAATACGACAACAAGAAATTTTATTTGGCAAAACCTTCCATTGAATTCTTGAGATTGTTGAATGTCAAGAGAATTGATGAATATCATCTCATCCCGAACGAAGAGAAAGACGGAACAGAAGAAGTCAATGAACGTGATTATTTGACAGATTCAGATGATGATGATGATGATGATGATGATGATATGGATGTGATATAA

Protein Analysis

71

Amino Acids

8.53

Weight (kDa)

4.05

Isoelectric Point (pI)

66.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011051)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 35, 62
AgsI TTSAA 3 cut(s) 20, 62, 79
AjuI GAANNNNNNNTTGG 2 cut(s) 26, 58
ApoI RAATTY 2 cut(s) 35, 62
BpuEI CTTGAG 1 cut(s) 88
BsaBI GATNNNNATC 1 cut(s) 99
Bse8I GATNNNNATC 1 cut(s) 99
BseGI GGATG 2 cut(s) 108, 211
BseJI GATNNNNATC 1 cut(s) 99
Bst6I CTCTTC 1 cut(s) 114
BstF5I GGATG 2 cut(s) 108, 211
BtsCI GGATG 2 cut(s) 108, 211
Eam1104I CTCTTC 1 cut(s) 114
EarI CTCTTC 1 cut(s) 114
EcoRI GAATTC 1 cut(s) 62
FaiI YATR 2 cut(s) 203, 214
FokI GGATG 1 cut(s) 95
FspEI CC 7 cut(s) 29, 66, 70, 114, 125, 126, 188
HinfI GANTC 1 cut(s) 167
Hpy188I TCNGA 1 cut(s) 172
Hpy188III TCNNGA 3 cut(s) 67, 85, 112
HpyAV CCTTC 1 cut(s) 63
HpyCH4IV ACGT 1 cut(s) 151
HpySE526I ACGT 1 cut(s) 151
MaeII ACGT 1 cut(s) 151
MboII GAAGA 2 cut(s) 131, 149
MluCI AATT 4 cut(s) 15, 35, 62, 90
PfeI GAWTC 1 cut(s) 167
SetI ASST 2 cut(s) 55, 154
SgeI CNNG 6 cut(s) 23, 43, 79, 97, 124, 164
SmlI CTYRAG 1 cut(s) 67
SmoI CTYRAG 1 cut(s) 67
Sse9I AATT 4 cut(s) 15, 35, 62, 90
TaiI ACGT 1 cut(s) 154
TasI AATT 4 cut(s) 15, 35, 62, 90
TfiI GAWTC 1 cut(s) 167
TspDTI ATGAA 2 cut(s) 111, 162
TspGWI ACGGA 1 cut(s) 144
XapI RAATTY 2 cut(s) 35, 62
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.