Rorug02G0007200
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Reverse (-)
646107 .. 646539
433 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0007200.1

Sequence Viewer

Length: 312 bp
ATGCAACTGACCACTAGTACAGCCACACTGAAGCTCCCACAAGGTTCCACTGGTGTTCTGGTCAAGAACCTCTGCTTGTCCTGCGATCCTTATACTAAAGTCCATATGACCAAGGCTAGCTCTGATACTCCTTCTTATATCAAAACCTTCACTCCTGGTTCGCCTATGACTGGATTTGGAGTGGCTAAAGTCTTGGAATCTGGGGATGCAAACTTTAAGCTAGGCGACTTGGTTTGGGGAATCACTGGCTGGGAAGAATATAGTCTCATAAATGCAACAGATCGAATCTCTGTTCAAGATTCACAACACTGA

Protein Analysis

103

Amino Acids

11.09

Weight (kDa)

6.02

Isoelectric Point (pI)

24.11

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ADH_N_2 PF16884 15 - 94 2.4e-19 N-terminal domain of oxidoreductase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 80
AcuI CTGAAG 1 cut(s) 50
AfaI GTAC 1 cut(s) 19
AfiI CCNNNNNNNGG 1 cut(s) 170
AgsI TTSAA 1 cut(s) 296
AhlI ACTAGT 1 cut(s) 14
AjnI CCWGG 1 cut(s) 154
AluBI AGCT 3 cut(s) 34, 120, 220
AluI AGCT 3 cut(s) 34, 120, 220
Alw26I GTCTC 1 cut(s) 269
AlwI GGATC 1 cut(s) 80
AsuNHI GCTAGC 1 cut(s) 116
BciT130I CCWGG 1 cut(s) 156
BcoDI GTCTC 1 cut(s) 269
BcuI ACTAGT 1 cut(s) 14
BfaI CTAG 3 cut(s) 15, 117, 221
Bme1390I CCNGG 1 cut(s) 156
BmiI GGNNCC 1 cut(s) 46
BmrFI CCNGG 1 cut(s) 156
BmsI GCATC 1 cut(s) 196
BmtI GCTAGC 1 cut(s) 120
BsaJI CCNNGG 1 cut(s) 111
BsaXI ACNNNNNCTCC 4 cut(s) 18, 48, 136, 166
Bsc4I CCNNNNNNNGG 1 cut(s) 170
Bse1I ACTGG 3 cut(s) 55, 175, 250
BseBI CCWGG 1 cut(s) 156
BseDI CCNNGG 1 cut(s) 111
BseGI GGATG 1 cut(s) 211
BseLI CCNNNNNNNGG 1 cut(s) 170
BseNI ACTGG 3 cut(s) 55, 175, 250
BseYI CCCAGC 1 cut(s) 249
BslI CCNNNNNNNGG 1 cut(s) 170
BsmAI GTCTC 1 cut(s) 269
Bsp143I GATC 2 cut(s) 85, 280
BspLI GGNNCC 1 cut(s) 46
BspOI GCTAGC 1 cut(s) 120
BspPI GGATC 1 cut(s) 80
BsrI ACTGG 3 cut(s) 55, 175, 250
BssECI CCNNGG 1 cut(s) 111
BssMI GATC 2 cut(s) 85, 280
BssT1I CCWWGG 1 cut(s) 111
Bst2UI CCWGG 1 cut(s) 156
BstC8I GCNNGC 1 cut(s) 118
BstF5I GGATG 1 cut(s) 211
BstKTI GATC 2 cut(s) 88, 283
BstMAI GTCTC 1 cut(s) 269
BstMBI GATC 2 cut(s) 85, 280
BstMWI GCNNNNNNNGC 1 cut(s) 81
BstNI CCWGG 1 cut(s) 156
BstSCI CCNGG 1 cut(s) 154
BtsCI GGATG 1 cut(s) 211
BtsIMutI CAGTG 4 cut(s) 26, 48, 243, 307
Cac8I GCNNGC 1 cut(s) 118
Csp6I GTAC 1 cut(s) 18
CviJI RGCY 7 cut(s) 23, 34, 116, 120, 185, 220, 249
CviKI_1 RGCY 7 cut(s) 23, 34, 116, 120, 185, 220, 249
CviQI GTAC 1 cut(s) 18
DpnI GATC 2 cut(s) 87, 282
DpnII GATC 2 cut(s) 85, 280
Eco130I CCWWGG 1 cut(s) 111
Eco57I CTGAAG 1 cut(s) 50
EcoRII CCWGG 1 cut(s) 154
EcoT14I CCWWGG 1 cut(s) 111
ErhI CCWWGG 1 cut(s) 111
FaiI YATR 7 cut(s) 93, 105, 107, 138, 167, 261, 269
FauNDI CATATG 1 cut(s) 105
FokI GGATG 1 cut(s) 218
FspBI CTAG 3 cut(s) 15, 117, 221
GsaI CCCAGC 1 cut(s) 253
HinfI GANTC 4 cut(s) 197, 240, 285, 299
Hpy188I TCNGA 1 cut(s) 124
Hpy188III TCNNGA 2 cut(s) 64, 296
HpyAV CCTTC 2 cut(s) 141, 157
HpyCH4V TGCA 3 cut(s) 4, 209, 275
HpyF10VI GCNNNNNNNGC 1 cut(s) 81
Kzo9I GATC 2 cut(s) 85, 280
LmnI GCTCC 1 cut(s) 39
LpnPI CCDG 9 cut(s) 36, 44, 94, 141, 156, 168, 186, 231, 235
LweI GCATC 1 cut(s) 196
MaeI CTAG 3 cut(s) 15, 117, 221
MalI GATC 2 cut(s) 87, 282
MboI GATC 2 cut(s) 85, 280
MboII GAAGA 1 cut(s) 266
MnlI CCTC 1 cut(s) 80
MseI TTAA 1 cut(s) 216
MspR9I CCNGG 1 cut(s) 156
MvaI CCWGG 1 cut(s) 156
MwoI GCNNNNNNNGC 1 cut(s) 81
NdeI CATATG 1 cut(s) 105
NdeII GATC 2 cut(s) 85, 280
NheI GCTAGC 1 cut(s) 116
NlaIV GGNNCC 1 cut(s) 46
PfeI GAWTC 4 cut(s) 197, 240, 285, 299
Psp6I CCWGG 1 cut(s) 154
PspFI CCCAGC 1 cut(s) 249
PspGI CCWGG 1 cut(s) 154
PspN4I GGNNCC 1 cut(s) 46
RsaI GTAC 1 cut(s) 19
RsaNI GTAC 1 cut(s) 18
SaqAI TTAA 1 cut(s) 216
Sau3AI GATC 2 cut(s) 85, 280
ScrFI CCNGG 1 cut(s) 156
SetI ASST 6 cut(s) 36, 46, 72, 122, 149, 222
SfaNI GCATC 1 cut(s) 196
SpeI ACTAGT 1 cut(s) 14
SspMI CTAG 3 cut(s) 15, 117, 221
StyD4I CCNGG 1 cut(s) 154
StyI CCWWGG 1 cut(s) 111
TaqI TCGA 1 cut(s) 283
TatI WGTACW 1 cut(s) 17
TfiI GAWTC 4 cut(s) 197, 240, 285, 299
Tru1I TTAA 1 cut(s) 216
Tru9I TTAA 1 cut(s) 216
TscAI CASTG 3 cut(s) 33, 55, 250
TspRI CASTG 3 cut(s) 33, 55, 250
XcmI CCANNNNNNNNNTGG 1 cut(s) 55
XspI CTAG 3 cut(s) 15, 117, 221
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.